Detailed Information [114056]

Strain Information
DGRC Number 114056
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP7054 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP7054 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 50A3
Map Viewer
Related Genes CG17047 CG17048
Original Number 7054
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7054

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 732
General Information NP_lines
Embryonic Expression weak muscle
Larval GFP fb, heart, lymph gland.
Larval X-gal ad cells, pns? on epi, gut, cns,
Adult GFP ubiquitous. strong internal large cells.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33415_0907
Strand Plus
Insertion Point 8402029
Chromosome Band 2R
Flanking Sequence
attttntgttcttcggtaagcttcggcttcgacgggaccaccttatgttatttcatcatg
CCGCTGACGACGAACAACTGTGTGTGCCGCGGAACTGTAAAAGGCAAAAGAAACGGTCGA
AATTTGTATAATTGAAACGGAACAGGGGGAACACGGGAAAGGAACGAAAGAGAGCGCAAG
AGAGCGAGTGGATGTTTCGCTTCCATTACGGTTCTCTGCTTATCACTgatcgaagaatac
ataagagagaaccgtcgccaaagaacccattattgntggggtccgttttcaggaagggca
agccatccgacatgtnatcctcttcagaccaatcaaatccatgaagagcatncctggggc
attaaattcaacggaattggggagttatcatgatgagctggcgngtcaatcgattcaagc
aactggcttttgacccttggtacctactctttttccnagatgatgnnccacttattttat
gctggctcaaaggtagangcatatnantcttcactgaaccatntttttttgggnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nntnnnnnttnnnnan

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)


CLOSE