Detailed Information [114070]
 

Strain Information
DGRC Number 114070
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP7085 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}NP7085 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 77E6
Map Viewer
Related Genes CG3947 CG4289
Original Number 7085
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP7085

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 2009
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression PNS?
Larval GFP weak gut
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33885_0907
Strand Plus
Insertion Point 20696800
Chromosome Band 3L
Flanking Sequence
annccttgggngaaaaaccccattttttgggatacttnnaaaaccttcggctatcgacgg
gaccaccttatgttatttcatcatgCGCTAATGCATTAGTAATTTCGAGAGCAGCAAAGT
CTTTGGTCACACTTTTGTTTTTGTGCACTTTGTAATCGAATTGCTCGTGAATTCGGATTC
ACTCCGTTTTCGTGTGTATTAGCTAGGCAAGATTGANTTTTTNGTCGATATACAGATGTC
CAGCAACAACACGGACACTGGGGACACCACCGTCATGGCGACGGCTACCTCGGTGCAGAA
CGATGTCGAGGCCGGCGTAGATGAGCAATTGCCTCGAGAATCGCTGGTAATATTTGTTCA
ACCCCTTCAAGTTTGCCTAATCTATAATCCGACTATTCGCCGCAGATAACCACTGCAGTC
AGTTTTCTACAAAACACCAAGGTGCGCCACACGACACTTATCCAGAAGCAGCAGTTCCTA
CGGTCCAAAGGTCTCACCGCTCACGAAATTCAGCTGGCCTGTGAACGGGCCGGCGTTTTC
ACCCAAGACCCCAACAAGCCCAATCCGAATCCGAACACCGTCATTAGCATTGGATCCNAG
AAGCCATCACNGANAACCGNCCCCAANGNCTNGGGNCNGNTNGGGTACNGNTTTCANGAA
GGGCNAGCCGTTCAGACATGTTNTNCTCTCAGACCAANCTNTNNANGGGGNAGCATGCCC
GGGCATANANNNCNACGGNANTNGNGAANNNANNNNNANGAGCNNCCNNGNCAATCNNTC
AGNNACTGNNNTTGNCCTTGgnactactgnnntncnatgnnnacggnnnacttnttttnn
gctttncnnaangntnnaggcntatnannntncnntgaacntnnnnnnngggnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnatn

CLOSE