Detailed Information [114072]

Strain Information
DGRC Number 114072
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP7092 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP7092 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35D4
Map Viewer
Related Genes BG:DS09217.4 Gli
Original Number 7092
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7092

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1203
General Information NP_lines
Embryonic Expression peripheral glia? (TU)
Larval GFP sg
Larval X-gal sg
Adult GFP ant, lab, abd.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33935_0907
Flanking Sequence
ANNGNNNNNNGNGGGGNGGGGNNNNGNGNAGGGGNNNGGGGNGGTTTNGGTTNTTGGGNN
NGATTCAGGNNNNNGTAANAANCCCCNTTTTTTGGGGGNNNNNNGAAAANCCTNNNGGTT
NGNGANGGGNANNTTTTTTGGGGGNNNNNNTTTNGNGGGGGGGGGGGGGGNNNNNNNNNN
NNNNNNNNNNNNNNGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTNNNNNTTT
TTTTTTNNNNNNNNNNNNNNTTTTTNNGGGGGGGGGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGGGGGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnann

Library Name / Clone Name np / np63213_0309
Strand Minus
Insertion Point 15740851
Chromosome Band 2L
Flanking Sequence
atanctttgggcgcactaatccgcaagtnttacgttaagtggatgtctcttgccgacggg
accaccttatgttatttcatcatgGGTTGGNGCGTCAGTTCGTCGGCATCNNTCGAAAGA
GTCGGNTGNCTCTGTGTTNTGGCGGTAGTGGNTGTGCGCACAGGTGAGAGTTCGGTGCGC
AAGAGGCCGTTAAAGTTAAAGCTGCGCGCGCTCAATACAACGAAAGANTTNNTTGGCCAG
GTGTATCTGTGNGCGAATCGTTGGNAACAGCCGGCAACTGAGTGTGAGTGTTAACTGAGT
TTCGTTCGTTGGTGTGCGTGAGAACTGAGAAGTGGTTTTTGGACGGTACATTGCGCTTAC
CTGGCTTACCTGTGTCTCAGTCTCCGCCGCCGACTCAAAAACGGTCATTTCAGCTGCGTT
ACGTTTTTTTCTCGCTTGNATTCAGNCTTGTNTTTGGTTAGNGATTTTTTGTTTGTTACC
TTTTCGGGGCGTTGGCCAAGAAAGNTATTGNGAGTGTAGAAACGCGTAAAAGTTGAAACT
AAAATGTGAGTGGNAATGGTTGGAAAATCNCGATTAGATAGATAGTGAAATGACGGATAG
AAAGCCGCAACAAGNTGCCACGGCAACGNCATNAATTGGAGCATAACCNGTAAAAACAGN
GAGAATTAAGCCCCCNGAGAAAGAATTCNCCTTGGCATTAGNAACAAAAACNATTTTAAA
AAAAAACNGCTTATNTAACAAACTTAAAAGATAAAGAANAGCTTCCAANATAAGANNCNC
TTTAAAAAAAAANTTTTAATtnncnnnaaaannnangannccnnnccnnngnntnngncn
nntnnnnnnnnananntnnntnnannnnnnnnnnnnnnnnnnnnnnnnntnnntnnnnnn
nnnnnnnnnannnnnnnannnnnnnntnntnntnnnnnnnnntnnnnnnnncnnntnnn


CLOSE