Detailed Information [114085]

Strain Information
DGRC Number 114085
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}NP7122 w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}NP7122 w* / FM7c
Break points/Insertion Site 2D2
Map Viewer
Related Genes ph-d FB{}23
Original Number 7122
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP7122

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 57
General Information NP_lines
Embryonic Expression cns + pns (ch)
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np04625_0711
Strand Minus
Insertion Point 1880336
Chromosome Band X
Flanking Sequence
ancttnggtgcatgccnttttttgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgTTCCAACCCCAAGCGAACGCACGGCATCCCGCTCGCACGCG
CTATCTGACCAGGGCCACTCCTAGTGGCGTCGCACTCGCACCCGTGCATTTCGGTATAGA
GAAAAGTTATTAGTCGCAACGGTATCTGAGAGGAGANATGCGgatcgaagaatacataag
agagaaccgtcgccaaaggaaccccattattgntggggtccgttttcaggnagggcaagc
cntccgacatgtcattcctctttcagaccaatcaaatccatgnagaagcattcctggggn
ataaaantccaacgggaattggtgggagntattcatggatgagctggccgaggtcaattc
gatacagncaactgggctttgaacntttgggtacctaccttttttcggannganagangg
gcgcnccttanttcntangctgtnnnaaaggttaganaggnttattaagnctncnnctgg
agccatttatatattngngngnnnnnnnnnntntnnnngnnnnnnngnnatnnnnnntnt
ntnnnnnngnggnnnnnnnatnnnanngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnttntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
n

Library Name / Clone Name np / np54703_0309
Strand Plus
Insertion Point 1880329
Chromosome Band X
Flanking Sequence
gtgttttngnaagatnnancgggggggaaanacacncctcnnggggggaagannaanccc
cctngccgacgggnaccaccttatgttanttcatcatgGGTTGGAANGAAACGGCAGCAG
TCTGACAAAGCAAAACCAAAACGAGTAAAAAAAACAGGGATCCNCNAGCNAGAGCTTGGG
CCNGTNGTGGANNGGGCAACCACTAGCTAGAGCGCGGANNANAAAAAAGAAAAATTTTTT
TTTAAACNNGANNCCGNTNNNTGGGGGGGGGGNNNGNNCCCNNGANGNCNACCGNCCGAC
TNNNNGGGGGGGGGGGGGNGNGCNTCACCNNCNNNNNNNCGNNCCNNCCCNNNCNCCNCN
NCNNGGNNNCCNGGAGCGCCNNNCNCCNNNGNGNGNCNNNNNNNCANNCNNNNNNNNNGN
NNGGCGGNGCNNGNNGGNNNNNGNCGNNCGNNGNCNNNGNNNNGGGNNGGGGNNGNGNNN
GCGCNGNGNCNGNGNGGNNNNNNNCNNCCNGNGGNCNCNNCNNNNCNNNNNGCNNNGNCG
GGGNNNNNNNNNCNNGNCNNNCNNGNNNNCNNNGNGGNCNNNNNCNCNNGNGNNNNNCNN
NNGNCNNNNNNGNNNNGCNCGCNNNCGGGGNNGNNNCNCCNNCNGNNCNNNNCCCGNNGG
GGNNCNNCNCNCCNNGNNNNGGCCNNNCCNCNNNCNNNNNGNNNGGNGGNGNNNGGGNNG
GNCGGNNNNGNNGNNNNGNNNNNNNNGGCNNCNCCNGCNNNNNNNNNNGGNNNGNGNNNN
CNGCCCCNNGNNNNGNNCGNnnnnnncccnnnnnnggnnngngngnnnngnngccgnggg
ncggggccccncnnnnnnnngnncnngnnnnggnnannngnnnnnnnnngncnnncnncn
gnnngncgnncgnncnncnccngnccgcgnnnnnnnnngngngnnnnannacgaaaaaaa
aaaaaan


CLOSE