Detailed Information [114116]
 

Strain Information
DGRC Number 114116
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}Sep4[NP7170] / FM7c
Genotype w* P{w+mW.hs=GawB}Sep4NP7170 / FM7c
Break points/Insertion Site 15A1
Map Viewer
Related Genes CG4678 CG9699 Axs
Original Number 7170
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP7170

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 395
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Grice SJ, Liu JL, Webber C.
Synergistic interactions between Drosophila orthologues of genes spanned by de novo human CNVs support multiple-hit models of autism.
PLoS Genet. (2015) 11(3) e1004998 [PubMed ID = 25816101] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np25095_0807
Strand Plus
Insertion Point 16425837
Chromosome Band X
Flanking Sequence
ggggnnantgnntgttngtttttttngnnnngattcacagngggtnnannnncncgtant
ttnggncnnncggtaagaccncggctattngacgggnaccaccttttgttatttcatcat
gGTGCAGCTGCTTCACCTTGACCTACACGACCACAAGTAACAGTGAGATGCACAATACAC
TCACACACACACACACAGCGCCAAATCACCGCTCTTACACACACGAAAAATAATAATAAA
AAAAAGGCTCACGCACTTTGTTATTAACTATTTCCGTTGTTTTGGTTTCCTCTTTTTTTT
TGGGGCAAAACTGTATGAAATTTCACCGAAAAAAAAATNGNCGGGGNAAATATTCCAAAC
TTNTANGGGAATNTTATTTACAATAACAAATATGGTTTTNTGAGNGGAGTTTTNAAACAT
ACACTTTCCGNGCGCTTTTACTGATGCTTTTTCACCGCCGTCGCGTCGAgatcgaanaat
acataagagagaaccgncgccaaanaacccattnttgtnggggnccgttttcagganggg
caagccatccgacatgtcatccttttnagaccaatcaaatccatgaagagcatccctggg
cataaaatccaacggaattggggagttatcatgatgagctgccgagtcaatcgatacaga
caactgncttngacctttggtactactctcttccgaagatgatggcgcacttattctatg
ctgtctcaatgttagnggcatatcagnctccactngcannnnnnnnnnnnggggnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnggnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnn

CLOSE