Detailed Information [114258]

Strain Information
DGRC Number 114258
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}bowl[NP7378] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}bowlNP7378 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 24C3
Map Viewer
Related Genes bowl CG31772
Original Number 7378
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7378

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1026
General Information NP_lines
Embryonic Expression ventral epistripe (db?)
Larval GFP no larva
Larval X-gal gut
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np18925_0807
Strand Minus
Insertion Point 3764666
Chromosome Band 2L
Flanking Sequence
acacttgtngggaanaacccntttttggggcnnctaaagccncggctatcgacgggacca
ctttatgttatttcatcatgCCCGAACCGAAACCTCAACCTCAACGAACTGAAAACCGAA
CGAGAACGAGAGATACACGGCAGCTGAAATGTGTTTTTCTACATTTTGTTTGAAATAGGA
GCTGAAGCCAGTGCAGCTACCAATTCGNTTTTTAAGTAGTCCCAAACTCTTCCCACACAC
AGAGTCAGTTGCAGTTGAAAAGCGCTTTTTCTCGAGGCAACTGGGCGATGCAACAAGTTC
ACTCACACACACACACACACTAGCGCTNTGGGCCCCGCTCAATAAGATACATCGGGGGGC
GAAAGGATACAGATAGATATAGAGCGAGGNGGCACTCACAANTGGCAGTTCACTTTTTTC
CCAACAGCTTTTTACCCAGCGGATCGAAGAATACATNAGAAGAGAACCCGNCGGCAAAAA
ACCCCATTATTGNTGGGGGTCCGTTTTCAGGAAGGGGCAAGGCCATCCCGACATGTTATT
CCTTTTTCAGACCCAATTNAAATCCATGGAAGAGCCTTCCNTGGGGCATNAAAATNCAAC
CGGAAATTGGGGGAGTTATTAATGAAGGAGCTGGCCGNGTCAATCGATACAGGCNAACTG
GCTTTTGACCTTTGGTTACTACTCTNTTNCCGANGATGATGNCCNCACTTATTTNTATGC
TGGCNCAATGTTAGAGGCATATNAGTCTCCACTGNACCATTTTTNTTTTGGGNNNNNNNN
NNGGNNNTTNNNTNNNNNNNnnnnnncnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnntntgnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnncnnnntnnnnnnnnnntnnnanantnnnanaaat


CLOSE