Detailed Information [114269]

Strain Information
DGRC Number 114269
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP7398 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP7398 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site ---; ---
Map Viewer
Related Genes CG40160 CG40162 CG40260 CG40315 CG40343
Original Number 7398
Chromosome 2
Comments NP line. Received from the National Institute of Genetics.
Balancer CyUW14
Cluster id 2061 2097
General Information NP_lines
Embryonic Expression sg
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np40015_0907
Strand Plus
Insertion Point 2874282
Chromosome Band U
Flanking Sequence
gngcactgantttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttatg
ttatttcatcatgCGCCAGTGTGTATAGCCATTAGAGAATATGATGAAGAAGGGACATGT
AAGAAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggt
ccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccat
gaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccg
agtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatg
tcgcacttattctatgctgtctcaatgntagaggcatatcagtctccactgaagccatnt
tttttttngggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnn

Library Name / Clone Name np / np64783_0309
Strand Minus
Insertion Point 671096
Chromosome Band U
Flanking Sequence
ttcactgcaagtcatacgttaagtggatgtctcttgccgacgggaaccaccttatgttat
ttcatcatgCACTGGCGTGTGCCACATTGTCATCTCTCTCTAACACACTATTTATGACCA
CTCGATCCTCTTATCTNGNAGCTTNGNGNACTTCGCGAATTANCCAAANATATTANNCTA
GAGAAATATAATNNNNNNNNNNNANGNGNNTTNTTAGAGNNNCNAAGNAAGAAAANAACA
NNNATTTNTNCCAGTTNNNNANGAGATTATNATANNGGTANNNGAGAGGGNNGNGANNNN
GNCGGANNANNATNANATATANTTATNACNCNGNTTANTNTCCNNTNTANGNNANATGNN
CNNNANTGGGNNCAGNGCCNCGAGANNTCNNTCAGNNNAGTANACGAANANTTTNTCANN
NNNNACCGNGCCNNTTTTNTNGANAANTNNNNNACNCNGATCGNNTTATATNACANCNCC
CGTANNATAGNAGATATNATAACNCGAANCGNNNTTNCNCGTATATNACNCAANCTTANN
TCATTCNNANNATNCNNNAATAGTNNNCNCNNCCCNNTNNANNNGATGNTTAGANCNNCT
NNTNCCNCATNCNCNCCNNANNTCGNNNTAGCNNNGNNCNNNNANNTATTNNTCNNNNAA
NTNNANNCCCCNNNCACNCCNNCNCCNANATTATCGCTCCCCNNANTTTNTCCNNGNNNC
NGNAGNGGNNGNGNNCNGCNCNGNCNCNNAATCNGNTAANCCAGCCAAAAAAAGNTNATA
NATGAAAGNANANTNANAGTcctncanngnangcgggagaacngagnngngngantatan
cnatangncatananntnttannnnntttnaannnntntgnantcncncgngngnnnnnn
nngtnaaggcgngnttatnngancccgcaatncnctgntatgnaatantngatnanannn
cactcnntccnnnnnntatanactanagatnntctntannanatnttanaaattnnctat
nangntntnttnttatnnnccgantncanntnnnttcaacaaanncanantagtanttan
cnacngnnnnnnaccccnct


CLOSE