Detailed Information [114294]
 

Strain Information
DGRC Number 114294
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP7448 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP7448 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 63C1
Map Viewer
Related Genes CG12078 CG14959
Original Number 7448
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP7448

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1762
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells
Larval X-gal sg, fb, gut, mt, oenocyte
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np40315_0907
Strand Minus
Insertion Point 3231178
Chromosome Band 3L
Flanking Sequence
tnaaaaaaattntntgggggcanaaccctttttggtacttcggtaagcttcggctatcga
cgggaccaccttatgttatttcatcatgGTTTGTGCATTTAAAGTTCAAGTTCAAAGCGA
GGCGGCGAGAATACGAATTAGAATTGCTAGAGGATTTGAGCGCAGAGAATTGAGAGCGAG
GCGCGAAAAATGGAGAATGGAGAGACAAATGGCCAAGTGCACGTACACCGCCGAATAGAA
GAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgntggggtccg
ntttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaa
gagcatccctgggcataaaatccaacggacttgnnggagttatcatgatgagctgccgag
tcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtc
gcacttattctatgctggcatcactgttagaggcatancagctctncactgtagnccaan
cnannctgcncnntcccntctttnttttncgtnccctcccntnccntctccccttntnnt
tcttttcnnncttncccgcccccccntcnnccgcctnttcccnttccnnttccctctnnn
ttntngtntttntcttnnnccnccccccnntnccnntcttctcncnctnttgcnccctnc
ccgctctctttcgnnnnngnnntcgtntccctgcncgnnnnccgngttttntccctcttn
ncgtccctcntttcgccccccctcnttctttttcnccncgccncncncggnnnncnntcn
ttccncttncctntcnntctgttcntnntcnncttttntttttnctngccnntnnccngc
ccgctttcgtgtnnntgnncgccgcgtgctccntttttcccccgctnnnncccncnnctc
tntancttgttnngtcnccgtcgtccnttttcncanntttnnanntaccancanannana
anaanaaaat

CLOSE