Detailed Information [114327]

Strain Information
DGRC Number 114327
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP7515 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}NP7515 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 87B12
Map Viewer
Related Genes Hsp70Ba DM88{}1295
Original Number 7515
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1459
General Information NP_lines
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np38955_0907
Strand Minus
Insertion Point 8293576
Chromosome Band 3R
Flanking Sequence
acnncttnggggcactgaaatcnaagtntatacttcggtaagcttcggctatcgacggga
ccaccttatgttatttcatcatgAGCGCAGCAGTATAAATAGAGGCGCTTCGTCTACGGA
GCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAGCGAAAGCTAAGCAAATA
AACAAGGCGCAGCTGNNCANGCTAAACANTCTGNAGNAAAGTGCTTGTTNAAGNGANTNA
NTNNNNNGTNTCCNGNNNCCNNNNNAANNANCTGNNNCNNCTGNNNTCNGNCNNANGNNN
TNNTGNTNNNNANNAGANCNNNNNANCNNNNANNANNTCNNNNAANNANANNNNNNACNC
NNTNNNTNTNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNnnnnnnncnnnnnnnnnnnnnntnnntnnnnnnnnnnntnnnntnnnnnnnncnn
nnnnnnnnnnnnnnnnnnnnnnnnnntnnntntnttnnncnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnntncnnnnnnnnnnn
nnnnnnnnnnnnnnntnntnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnntnnttntt
ntntnnnnnnnnncnnnnttnnnnntnntnnnnnnnnnttnnnnntttttttnnnncnnc
nnttttntntnntttnntnnnncnnnntntttnnnntnnnnnnnnntnnnnntnnnnnnn
nntntnnnnccccnnnnnttccccnctccnnntncccntntcncnttcncctcnnnntnc
ntttttcnccnntttnnntttttntcccnncnnnttttcncnttntttttttttttttcc
ccncttttttccnnttttttccncnannaanat

Library Name / Clone Name np / np64533_0309
Flanking Sequence
ATCTTTTCATGCNCATTANTGGCAGGTCTTCNGGAGTATAATTCAGACCCCAGGAACATG
CTAAGGGTTAATCNAACANTACATATCCGCTGTCTCACTGCANANTATANCTGNTNATGC
NCCGNTANNNTATNNCNCCNCCTNTTTCCTNTTTTTTTTTTCCACNNTATGNNNNNTNGC
TTCNNNNNNTCNNACCCCCNNCTTNCTCGNTTNTTTNTNTTTGTNCNNNNGNACCGTNNT
TAATTANTNNNTCTTTNCNTCNTTTTTNNGCCGTTNACCCCANCTCNNTCCTNTNNTTAT
TTCCCTNTANTANCTNNCNNNNNNNTTCTNCGATTTTNTATTTNTNNTNTTNTNNCNCCT
CTNNNNNCNCTCTTATCNCATNTNNCCCCCNGTCNCCTCTTCCCCNCTCNANTGCTNTGN
NTGTNNANGNNCNCTTTNNATCCNTACCCCCCCGCNCNTATTGTTTTNGAGNCNCNNCCC
CCCNCATTCCCTTNTCANCCCNTCCCNCNNTTNNTNTATTNTNNATTTTTTCGCCNCGTN
CCNATCNTGCNNNTNTTCTNANTTNCTTNATNNNTTCNNANNGATCCNNTCATNNGTTTT
CNTNATCCANTTCNTTATTNTATNATNNNTTTNNGNNCNNNCNCNCATNGCNCCCCNNCT
CTNTGTCCNTCTNNTNGNACNNGCCTCTCTTTNTNTNTNTTATNTTTTNTATATTNNACN
CTNTTNCCCCNCCNGNCTCCAATTTNTTNCTCCCCCCTTNNTTTTNTCNCGTATTCCCCG
NTTCTNTCTNNNNANCNGCCccgcnccnnagnnatnntcnngctcgcccntcncnntnna
attcanttnttattnatctaccncnntntttttgnncgcnntnntntngtggtacgnnna
ttttctcntcttctattngtatntcgccgttnnnntactantcngntactgtnttgncnc
ntntnncngnccncngnnncggatncctnanngtatganntngagatcnnnnnnnntcnc
cnnttcctntgttattnttttattnntgnccntctnncncncncnnccnatttttngttt
tttnttcttntctatntcgttnanattnnttatcacctngtcnctntctcantttctntn
tngcccgttatngntccttttntntnccnttcgntagcnttntgtgcntcnncctnncgn
nctctnccncnncntcg


CLOSE