Detailed Information [114328]
Strain Information
DGRC Number 114328
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP7518 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
w*; P{w+mW.hs=GawB}NP7518 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 85B7
Map Viewer
Related Genes osk pyd
Original Number 7518
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP7518

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1396
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Larval X-gal sg, epi, cns, tr, hg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np69625_0810
Strand Minus
Insertion Point 4757625
Chromosome Band 3R
Flanking Sequence
atncttggncgtgcantncanttttttgtatacttncggtaagccttcggctatcgacgg
gnaccaccttatgttatttcatcatgGTTCAGATTATCGCGCTTGTGCGGTTGTGCGGAG
CGGACGAGTTGAAATGGCCGAGTCGTGAACTTGAAATCTATACAGGCGTTTTAAAACATA
AACAAACAAATACGAATGCGAAAGAGCCGGTAAAAGTTTAAATGTTTgatcgaagaatac
ataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggca
agccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggca
taaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtca
actgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgct
gtctcaatgttagaggcatatcagtctccactgagctnttttnntttnggggnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE