Strain Information | |
---|---|
DGRC Number | 140229 |
Genotype with FlyBase Link | y[*] w[*]; PBac{SAstopDsRed}LL01019 P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1] |
Genotype | y* w*; PBac{SAstopDsRed}LL01019 P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1 |
Break points/Insertion Site | 38F1 |
Related Genes | CG31673 |
Received Date | 19 October 2007 |
Original Number | LL01019 |
Chromosome | 2 |
Original Source | Liqun Luo, Stanford University |
Original Comments | Location: 2L:20830210(+) Cytological Band: 38F1 Gene Symbol-1: CG31673 CG Number-1: CG31673 FlyBase ID-1: FBgn0051673 Insertion Type-1: Intron Gene Symbol-2: CG Number-2: FlyBase ID-2: Insertion Type-2: Location coordinates are based on the Drosophila Genome release 5.0. IMPORTANT NOTES: Oren Schuldiner (Weizmann Institute of Science) |
General Information | MARCM |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Reference | Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L. piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning. Dev Cell (2008) 14(2) 227-38 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
|
Stock Request |
Library & Clone Information |
---|
Strand | Plus |
Insertion Point | 20830210 |
Chromosome Band | 2L |
Flanking Sequence | tttacgcagactatctttctagggttaaGTACACCTAATACTTACCAATCATTAATACGT TTCATATGAAAACATAATATAATATAAAAATATTTACAGGTCCCAATGGAAAATcgaatt aaccattgtgggaacactagaac |
Sequence Comment | Location coordinates are based on the Drosophila Genome release 5.0. |