Detailed Information [141296]
 

Strain Information
DGRC Number 141296
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E PBac{SAstopDsRed}LL04591 / TM6B, Tb[1]
Genotype y* w*; P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E PBac{SAstopDsRed}LL04591 / TM6B, Tb1
Break points/Insertion Site 100B8
Related Genes CG1750, CG12114
Received Date 9 November 2007
Original Number LL04591
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3R:27079843(+)
Cytological Band: 100B8
Gene Symbol-1: CG1750
CG Number-1: CG1750
FlyBase ID-1: FBgn0039836
Insertion Type-1: CDS
Gene Symbol-2: CG12114
CG Number-2: CG12114
FlyBase ID-2: FBgn0039837
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 27079843
Chromosome Band 3R
Flanking Sequence 
tttacgcagactatctttctagggttaaGTCTTACTGATAGGTTGTTAATAGTATCCACA
AGTAACTCGGCTCCTAGCGACGCCAAAGATGCATGCAGATCCGGCATGAAGACATCGGGA
TTAATAGCCACTTCTCGCTGAGCTAAAATCTAAAGCATAAGTCGTCAATACTACTGCATA
CAATGGTAAGATAAGAATGAACTTACATCACCGATATcgaattaaccattgtgggaacac
tagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE