Detailed Information [201420]
Strain Information
DGRC Number 201420
Genotype with FlyBase Link y[1] w[67c23] P{w[+mC]=GSV3}GS8144 / Binsinscy
y1 w67c23 P{w+mC=GSV3}GS8144 / Binsinscy
Break points/Insertion Site 18D10
Map Viewer
Related Genes CG12238(CT13424)
Received Date 2/12/03
Original Number 8144
Comments Received from Tokyo Metropolitan University.
Original Comments Vector: GSV3
Location (tagged genes): Intron
Function / Process (tagged genes): enzyme
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2017-11-21
Research papers using this strain
[Please submit your publication]
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]

Library & Clone Information
Library Name / Clone Name GSV3
Insertion Point 19471444 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
TGGCAACACTGACGCGAATTCACCACGCTGGCGGCCAAATCCACCACAAGCAGTCGATGC
CGCTGCATGGAGAAAATCCACACACACACACACACATACGAAGGAGCACGACACGCACAC
ACTCATATGGGTTGGTTGCCCTGGCCTGCGTATATGTATGCTTACATTTCTACTGGCCAA
ATGCAAGCATCTATCTATCTGCACTAGGACTAATATTATTGTGAGCACGATTTTAGAGCG
CAATATCGACAGCCA
Sequence Comment X:19471145..19471444dmel-X-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV3
Insertion Point 19471444 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
CCCTGACCCAACACCACCACTACAACCACTACCACTACCAATACCAACGACAACAACAAT
AACGAACGGGGCAAAGAAGAAGCAGCAACGACAAGCAAACGGCAAACTCACCATGCGGCA
AAGTCGTCGCTCAGAGACAGACAAAAGAAGATGGTGGAGTAGAAGAGCGCCTGCTTTTGA
TTTGCGTGCACAATTCGCGATTGCGATTTGGATTTGCTATTTCGTTTGCCTTTGCCTTTG
CTGGCATTGGCATGCTCATATTTCTATGCACTTTGATTGATGCTGCGCGACGCCGTGCGG
Sequence Comment X:19471444..19471743dmel-X-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE