Detailed Information [201514]
 

Strain Information
DGRC Number 201514
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV7}GS20470 / TM3, Sb[1] Ser[1]
Genotype y1 w67c23; P{w+mC=GSV7}GS20470 / TM3, Sb1 Ser1
Break points/Insertion Site 066D10
Map Viewer
Received Date 2007
Original Number 20470
Chromosome 3L
Comments Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 8649426
Vector: GSV7
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV7
Insertion Point 8649426 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 066D10
Flanking Sequence
ACTGTTTAGCGACCCCCGAGCCGCAGATACACAGTACACAGCACAAAAAACCGAACCTGT
CGCACTGGGGTGGCGTCATATAGCCAGCTATTTTCACCTTCTATGGGACGTCGTCGCGTT
GGCCGCATGAATCAGCAAACCACGAACGGCGAGCCACCAGAAACCACCGCAGAAGCAGCA
ACAACACCAACACCACCGCGACCATCACCAACAGCACAGCCAGAAACACAGCCTCTTGTG
AATCCCTCAGTTAGC
Sequence Comment 3L:8649127..8649426dmel-3L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV7
Insertion Point 8649426 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 066D10
Flanking Sequence
CGACCGACGATCACCAATGGGGGTTTCGCAGTGTGATTTCCAAAAAGGAAGAAATGCCCA
TTCCCGCGAGCCACGGGGGCGTATGAGTAACGCGGTGTGTACTTTAGGTACCGCTCACAA
GCGTGAGCACGCACACACACACACACACACTGAAGCGAGCAGGTAGCGCATAATGTATAC
CCCTAGGTAGCCGCAATGCCAGTGCAATTGTATTGGTGCGGTCGTGTGGCTCGCGCTCGC
GTCTCGCAGCGGCGATTTAGCCTACGAACCTGTCGATCAATCGTCAGTCTTCCGCCGAGA
Sequence Comment 3L:8649426..8649725dmel-3L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE