Detailed Information [202703]
 

Strain Information
DGRC Number 202703
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV6}Rac2[GS10622] / TM3, Sb[1] Ser[1]
Genotype y1 w67c23; P{w+mC=GSV6}Rac2GS10622 / TM3, Sb1 Ser1
Break points/Insertion Site 65F11
Map Viewer
Related Genes Rac2(CT14366)
Received Date 2/18/03
Original Number 10622
Comments Received from Tokyo Metropolitan University.
Original Comments Vector: GSV6
Location (tagged genes): Upstream
Function / Process (tagged genes): cell cycle regulator
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 7409250 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
ATTTATCGCGAAAGTTGTCAAATCAATATTCTTAATTGAAAGCAGAACCGTGACGGCGTT
CTTTCTGTTCGGTCGGTATATTATTTATGAATTAATTGGGCCCGCATATGTGGGGATTTG
CTGATTTTCTGTGGCAGAAACGGAAAAAACACGCCCAAACGCTGTGAAATCTTCGCGGCG
ATTGAAGAAAATTTCTGCCTCCGCTGGCAGTTGTTGTACTTGTTTTTTCACTGTAGTTTT
CGCTCTTTCAACTGG
Sequence Comment 3L:7408951..7409250dmel-3L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 7409250 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
CGAAGCGCTGCGCGCATACGCTCTCCCACACAAAGAGCGAGCGAGCGAACGTGAGCGAGA
GCGGCACTGGCACAGTGCAGTCCCATAAAATTAGTCACAGTGAGTCATTCGCTCGGTGAC
GTTAGTCGTGGCAATCCACAGAGAGCAGAGCGAGACAGAGATAGTGAGTCTCTTTACTTG
ACCTTGCTTTGGTCGTTTTTGTAGAGTTTTCTATATTCGTTCGACGGTTTTCCACGAATT
TCCCGACCGTTGCTGTTGTTTTGAGCCAATTTCCACGCGACTAGAGGCTATCAGAGATGT
Sequence Comment 3L:7409250..7409549dmel-3L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE