Detailed Information [204597]

Strain Information
DGRC Number 204597
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV7}GS22967 / TM3, Sb[1] Ser[1]
Genotype y1 w67c23; P{w+mC=GSV7}GS22967 / TM3, Sb1 Ser1
Break points/Insertion Site 087B10
Map Viewer
Received Date 2007
Original Number 22967
Chromosome 3R
Comments Cy, SM1 floating. 3Oct2018 T.O.
Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 8267097
Vector: GSV7
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2018-10-03
Research papers using this strain
[Please submit your publication]
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV7
Insertion Point 8267097 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 087B10
Flanking Sequence
TAACCCCAACAGCTGCGTTGGCTATCCCCATTATTAACTTTCGGTAATTGTATTGTTGAC
ATGCCCTCATGGTAATTGACTCCAAAACTTCAGCGCCTATTTCGGTTTCAATTACGCACT
TCAGGTATACATATTTAGGTACTAGTTCGAGGTATATAGAAAGTATTTGTCATTTCGCCG
ATGTTTACGATTTCATGAAGATTAGGGCGCCCGCTGGGGCTACGTGCATGCCGGTAATCT
GGGGAACTCGGGAGA
Sequence Comment 3R:8266798..8267097dmel-3R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV7
Insertion Point 8267097 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 087B10
Flanking Sequence
TGTCCCGCCGATTTGCTTAATCGATTTGTTTTCGTTTTGGCAACCGTGCGAACGTTTGGT
CAGTTCCAATCGAGTTCATCTGGTGTGCGGACGTGTGCTTTCGCCACTCCTACACTCAAA
AATATATTGCAATCACATTGAAAGACCGATCGCAGAGTCCTCAGTACTCGGACTACCCAA
CCGACTGTGGAAAAGTGATAAAGTGCGAGTTTTTGGGAAGCTGAAGTAAAACAGGTTCGT
TTTCCACCTGGCCACTTGTTGAGTCATTGCAATAGGATTTGTATATTGTACACATATATA
Sequence Comment 3R:8267097..8267396dmel-3R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.


CLOSE