Detailed Information [205966]

Strain Information
DGRC Number 205966
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV6}GS14813 / SM1
Genotype y1 w67c23; P{w+mC=GSV6}GS14813 / SM1
Break points/Insertion Site 037A01
Map Viewer
Received Date 12 December 2006
Original Number 14813
Chromosome 2L
Comments Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 18684729
Vector: GSV6
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2017-11-21
Research papers using this strain
[Please submit your publication]
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 18684729 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 037A01
Flanking Sequence
TTGTTTGCGTCGCTTGGGGTGCACACAATCTCTTCAGCTGATACGCCGTACAATGCGTAG
AATCCCGATTACAATTTCGCACCACACTAAATTTTCCTTGCTCGCCCTCGCAAAAGAACC
GCTCTTTTCTTGGCCAGAATCTAATGGATTTATCGTTTTAAACGTGGCGTTCTTATCGCA
CGTGGTGACCGCATTTAGGCAGCAGTTTTTCGGTTCGTTTTTGAACGTTCTTTCACCGCT
TTTTCCACAATTGTC
Sequence Comment 2L:18684430..18684729dmel-2L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 18684729 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 037A01
Flanking Sequence
GTTTTGCTGGCGTTGCCACTTTTCGCCAAAGCGCAGAGTTGATTGGGGGCATAGAGATGG
CAATTTGCTGCGATGCACGAGCTGAGCACGACAGTCACGAAGTGAAAATATTTTCACGAA
ACTGTACTTTGTTGCACATAATAGCTAATAGCTAAGTTAACACGAGCCGACGAACTAGTA
CAGTTGGCTTAGTGTATGAAACATAATATCAAAGTGCTGAGACAGCATTGGGCCGGAGTC
TTTGTTAGCTTTAAGAATCATTTTAAGTTTCAGCTTAAATTTGCAGTTACCAGAATAAAG
Sequence Comment 2L:18684729..18685028dmel-2L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.


CLOSE