Detailed Information [206975]

Strain Information
DGRC Number 206975
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV2}GS50355 / TM3, Sb[1] Ser[1]
Genotype y1 w67c23; P{w+mC=GSV2}GS50355 / TM3, Sb1 Ser1
Break points/Insertion Site 077C01
Map Viewer
Received Date 2007
Original Number 50355
Chromosome 3L
Comments No Sb[1] expression. 18Jan2012 Y.K.
GS lines. Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 20335120
Vector: GSV2
General Information GS_lines
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2017-11-21
Research papers using this strain
[Please submit your publication]
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV2
Insertion Point 20335120 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 077C01
Flanking Sequence
TGCGATGCCCAGGGCCAGAAGGTCACAGGCTCCGCCGGGCGTCATTAGCTTCTCCCTGAT
GGTCTGCAGCATCTTGGCATTGGGGAACTCCTTTTTGGGCGTAAATAATCCCAGTACGGT
GTCCTCCTGGCTGCTACTCATGCCGCTGCTGCTGGATGATGAGGATGAGGAGGTGGCGGC
TGCGACTCCTGGCGAGACTGGTGACGAATAGTTGACTATTTTGCTTGTGGACGCTGACGA
AGCCGTTCTGCTGTT
Sequence Comment 3L:20334821..20335120dmel-3L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV2
Insertion Point 20335120 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 077C01
Flanking Sequence
CTTAACTTTATCACAGTTCTTGCTCTCGCTACGTTTTCTTCGTCTTATTCTCTGCTAATG
CTTCTTCTTACTAATTTTGTTACTCCGCTTTAGCCTGGCTGTACTTGGCTGTTAATTGTT
TTGACATTTAGCGACGCGCCGTTTAGTCTCCGATTAAATTCGATTTAAACTCTCGTTTAA
ACTCAGGGCTACTACTACTTCGGTAGTTTGGCCATTTGCAATGCGGGTACTGACGAAATG
CGGCGATTTTAAAACAAATCGGACGCTGCTCACTGAACTCGCGAAACGAAACGAACGCGA
Sequence Comment 3L:20335120..20335419dmel-3L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.


CLOSE