Detailed Information [103623]

Strain Information
DGRC Number 103623
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0501 / CyO
Genotype w*; P{w+mW.hs=GawB}NP0501 / CyO
Break points/Insertion Site 45A2; -; 45A3
Map Viewer
Related Genes CG13741 CG8078
Original Number 501
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0501

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 616
General Information NP_lines
Lethality lethal
Embryonic Expression sg, a small # of cells
Larval GFP fb
Larval X-gal sg, fb
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05555_0711
Strand Plus
Insertion Point 4156034
Chromosome Band 2R
Flanking Sequence
nanttgtnacttcggtaagcttcggctatcgacgggaccaccttatgttatttcatcatg
CGTGGAGCGAACATCACCGCATTGGAAACGATTAAAAAAAATATATATAAAAATGTAAGT
ATTATTGATATGATAGGCGACCGGTGAGTGCAGCGATTATAACTGCAAATCGAGTTCTAC
TGGCTTGTTTGCAGAACTCAATGTTGCAAGATTAATTTGTGATGCGCAGGGAAATGCACT
TCACCGATTGCAATTCAAATTGCAGTCACGTGGTCGAGAATCCATTTGCAGTCTCACAAA
TTAAAAATTAAAAAAGAACGTTAGCTAAACCGATGCGTTTGCTTATATTGCAGGGTGAAT
CTGNGATTACTAGGCGCCTGGCGTTAAAGCCGCTGGCATTTGNGAAATTGGGAAGGTTCA
TCATTGGATTTAATTATATTTTTGGTAAAAAATATTAATATTTTCATGCCAACCTNAGTC
GNCTGGNGGNAAANAACCNCTTCCTTAGCCTGGGCTTTTTACTTGGTCGNANAAANCGGC
TTTGCCCAGCCNTANCCCAATTTNAAAAANCCCGGTTNGGGGGCCNNTTNTTTTCNGGGA
GCCGNNNGNTTNAACCCNTTTACNNGCTAGTTTAAGATTTTGNGANANGGNTTACCCNAN
CTTCCNTTTTCANAACAAAAAGGCCCTTTTTNNCCANCCCNNNTTTTTTTGCNAAATTTG
AAAAAAAACAACCGGNANAATTTCTTTCCAAACCCCAAANNAGCCCCNNCAAGGTTTCNG
GNNATTNNAAATNTNNTTTTcggcncccccttngaccngnggggttcnaannggtttnac
tattttngaccctncccctctacaaaaannattttantggggccgggccttntgnaacct
ntttttttncnttngaaaannantanaaaacccnccn


CLOSE