Detailed Information [103646]

Strain Information
DGRC Number 103646
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Gdh[NP0546] / TM3, Ser[1]
Genotype w*; P{w+mW.hs=GawB}GdhNP0546 / TM3, Ser1
Break points/Insertion Site 95D1
Map Viewer
Related Genes CG12268 Gdh
Original Number 546
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0546

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:95D
Balancer TM3 Ser
Cluster id 1613
General Information NP_lines
Lethality lethal
Embryonic Expression a small # of cells
Larval GFP gut
Larval X-gal epi, gut, mt
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np41305_0907
Strand Minus
Insertion Point 19759515
Chromosome Band 3R
Flanking Sequence
GCCTTAAAGTGTATACTTCGGTAAGCTTCGGCTTCGACGGGGACNCCTTATGTTATTTAT
CATGGGGTTGTGCAGAACAGAATAAAAAAGAGTTGGAACCCCGAAGAATCCAAGCGATTA
GCAGCATGTATCACCTGAAGAGTCTGGCCCGCCAGGGGCGCCCCGCCGCCAGCAGGAGCT
GGCCACGCTGGCCAAGGCACTGCCCACCGGTGNGATGCAGTCGAGCCGGGGNTNTNCCAC
CGAGCACCAAGATTNCCGACCGNCTTAAGGGTGTGCCCACCGGCNAGGGTTNGAGAATTC
NTTAGANNGAACCGGTGNCNAAGAACCCATTATTGGTGGGGTTCGTTTTTAAGAAGGGNA
AGCCNTTCCANATNTTATTCTTTTNAAANCCATTAAATTCATNNAGAGGATTCCTTGGCA
TNAAATTCAACCGGATTNGGGAGGTANTATGNAGAGGCNNGCCANTTAATNGNTNCANGC
NAACTGGGTTTTGCCCTTGGTACNCCCCTTCTTTTCCAAGGAGAAGGNCCACCNTNTTTT
TNTNGNTTGTTTAATGNGTAGAGGGNTNTTAANCTTNANTTGAGCCATTTTTTTTTGGGG
NNNNNNNNTTTNNNNNNNNTNTTNNNNNTNTTNTNNTTTNNNNNNNNAANNCNNNACGGN
NTTTTNNNNNNTNNNNNNNNCNCTNTTTNTNNNNNNNNNNNNNNNCNCNTNTTTTTNNNN
NNNNNTNTNTNTTNNNNNNNTTTNNNNTNCTCNTTTCNCCTNNTTTTTTNNNNTTNNNNT
TNTNNTTNTNTNTTNNNNNTnnnnntnntnnntnnttttnnnnnnnnntttttcnctccn
tntttntnnntttttttnncnnnnnnnnnnnntnnnttncnnntnnnttnnnnttttttc
tttcnanaatg

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)


CLOSE