Detailed Information [104078]

Strain Information
DGRC Number 104078
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}svr[NP2073] w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}svrNP2073 w* / FM7c
Break points/Insertion Site 1B6
Map Viewer
Related Genes EG:171D11.5 svr
Original Number 2073
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2073

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 13
General Information NP_lines
Embryonic Expression restaiin, scattered cells
Larval GFP cns
Larval X-gal sg, cns
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np26915_0807
Strand Plus
Insertion Point 257331
Chromosome Band X
Flanking Sequence
GTTCTTNGGNAGCTTCGGCTTCGACGGGACCCCTTATGTTATTTATCATGCAACGCAGCA
AATTTTAAACAGTTGACTTTTCGAGCCTGAGCTGCAACGACGACCCACGACGAACGGAGG
CCCGACGGACATATAAGAAGAGAGCGAGTTGTGTGCGGGAGAGAGCTGAGAAGAAGCGGA
GGAAAAATAACTGTTTCTCGCTCAATTCGCACGCCAGTGATAAAAACAACATAATCTCGA
CAAGATTGCAAATCGCAAGATGCCAACTCTGGGGTCTCCTGTTCGCCTCCATCGGCATTG
CCGTGCTGGCGATGGGGTGTGCCCGCATTGCAGGGGCTACACCATCAAGGGAGGACGAAA
TCCTTTCCTGCAGCAACCCGCACTTATGCTAGCCCAAGAGCAGCTGGAGGGACCCTGTTT
TGCTGGCCCTGGAGAAGGCGTACCCCCAATCAGGCCCAAAGTCCACTTTCCTTTGGTCGA
TCGAAGAATACATAAGAGAGAACCCGCCGCCAAANAACCATTTTTGGTTGGGGTCCGGTT
TTAAGGAAGGCAAGCCATTCCACATGTATCTTTTNAAACCAATCAATCATGAGAGCTTCC
TGGCATAAATCCACGGATTGGGAGTTTTATGAGAGCTGCCGGTNATCGATCAGCAACTGG
CTTGACCTTGTACTACTCTNTTCGATGATGATGNCGCACTTATTCTATGCTGNCTAATGT
AGAGGCTTTTCAGTCTCACTGAGCTCCTTTTTTNTNGGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnn


CLOSE