Detailed Information [104123]

Strain Information
DGRC Number 104123
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}svr[NP2198] w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}svrNP2198 w* / FM7c
Break points/Insertion Site 1B5
Map Viewer
Related Genes EG:171D11.5 svr
Original Number 2198
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2198

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 12
General Information NP_lines
Embryonic Expression scattered cells, SG
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np27805_0807
Strand Minus
Insertion Point 253931
Chromosome Band X
Flanking Sequence
gannggtttttttggnnnggannntnttgnggtcaanaaacccantttttanacttncgg
taagncttcggctatcgacgggnaccaccttatgttatttcatcatgACGCGAACGCAGC
AGCGACCACTGTTGCCACTCGGCTGCgatcgaagaatacataagagagaaccgtcgccaa
agaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcct
cttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtgg
agttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttac
tactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgntagaggcatat
cagtctccactgaagccatcttattntgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaaaaaaaaa
n

Image Files
Disc

d1 (->Large)


CLOSE