Detailed Information [104166]

Strain Information
DGRC Number 104166
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2352 / CyO
Genotype w*; P{w+mW.hs=GawB}NP2352 / CyO
Break points/Insertion Site 55B7
Map Viewer
Related Genes Spn6 Dip3
Original Number 2352
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2352

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 842
General Information NP_lines
Embryonic Expression cns + pns subset (ch)
Larval GFP muscle, fb
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np21125_0807
Strand Plus
Insertion Point 13192193
Chromosome Band 2R
Flanking Sequence
gagggnnngnttgttttnttttnttgggnnnattnnnacggntgtnatnttgccnttnta
ttntgggnctncggnaagacctnggctattgacgggaccaccttntnttatttcatcatg
CGCAAGACCAGCCGAATTGAGTCTGCGCAGAGCGCGTAAAACCAAAACGAAGAGAACGCA
GGAGAGTCGAACGGTAAATCGGTCGCAGCAACATAAACTTTTAGAATCGCCAGCGAGAGC
CGTCTTAAAAGTGCGAATACAAACAGAAGGAAAAGCGGCCGCCTANGGGAACCTGACTAG
CAAAACAATCGAAAGCAATTGGCCAAAGTTAGGACGAAATGAGCCGAAAGAACGGAAACC
AGGACACCTTTCCCAAGACGGAGAAGATGCAGCGCTACTACGCGGAGCGCGAGACCACAG
GACCCGAGTTCGGTGAGTTTTCCTCGGTTCGCAATCGGTACACAATGGATTCAGAAATGG
AATCTGAGTAACCGGGGCTCGCAGAATCAACCCCCAAAGCCAAAGGATGTGTCTTCTGCG
CTTAGGGGTTGCTGTTTCTGCGGCGAAGAAACGTAGAAACGGAATTAGAAAACCAAAACA
GATTTTAACGATTTTTCCCACAAATCCTTGCTCCCAGACgatcgaagaatacataagaga
gaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatcc
gacatgtcatnctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatcc
aacgggaattggggagttatcatgatgagctgccgagtcaatcgatacagtcaactgnct
ttgacctttggtactactctcttccgatgatgatgtcgcacttattctatgctgtntcaa
tggtagaggcatatcagtctccngcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnggnnnnnnnnn
nnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE