Detailed Information [104185]

Strain Information
DGRC Number 104185
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2392 / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP2392 / TM3, Sb1 Ser1
Break points/Insertion Site 95C13
Map Viewer
Related Genes CG5338 CG5854
Original Number 2392
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2392

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1612
General Information NP_lines
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np21435_0807
Strand Minus
Insertion Point 19749981
Chromosome Band 3R
Flanking Sequence
GCTTGGCTTCGCGGACCCCTTTTGTNTTTATATGACCTGGTCCCTCTTTAAACGTACTTG
CCATCGTCCATTTTGACTAAAGTCAGCAAACTAACCGGAAGCAAACCTTTTTCTTCTCAA
AAGGTAAGACTTTTTTAAATACATACATACATATATCGGACCCATGAGCCTTAAAAACGT
GCTTTCAAGAACGTAGAGAGCAACATGCCTGGAGTCACAGTAAAGGAAATCGATCGAAGA
ATACATAAGAGAGAACCGNCGCCCAAGAACCCATTATTGNTGGGGNNCGGTTTTANGGAA
GGNAAGCCNTTCGACATGTTATTCTTTTTAGACCAATNAAATCCNTGAAGAGGCCTNCCT
GGGCCTAAAAATCCACGGGATTGTGGGGGTNTTATTGGTGAGGCGGCCGNGNNAATNGGT
ACAGGNAACNNNTNTTTGGNCCTTGNGACCACCNCCNNTTCCGGGAGGGGNGNGGCCCCT
TTTTTTTTGGGGGGNCAAAGGNNGNNGGGNTNTTAANNNTNCCCTGGAGCAACTTNTTTT
TTGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNN
NNNTGNNNNTNNTNTNGNNNnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnntnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnntttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntntnnntnnnnnnnnnaa
n


CLOSE