Detailed Information [104221]

Strain Information
DGRC Number 104221
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}RhoGAP19D[NP2497] / FM7c
Genotype w* P{w+mW.hs=GawB}RhoGAP19DNP2497 / FM7c
Break points/Insertion Site 19D2
Map Viewer
Related Genes RhoGAP19D CG15461 transib2{}185
Original Number 2497
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2497

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 480
General Information NP_lines
Embryonic Expression asp, psp, sg
Larval GFP tr terminal cells, CNS axon.
Larval X-gal tr, hg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np23585_0807
Flanking Sequence
TTTGGNNNAACACCCACCTGGGGGGGAAAAAAAACCCACTTTTTTGGGGGGCCNNNGGAA
AANCCCCCGGGCTATCGACGGGGACCNCCCTTTNTGTGGANTTNCAATCATGGAATCCGA
AGAAACACANAAGAAGAAGAAACCCGNCCGCCCAAAGAACCCNATTANCGGNNGGGGGTC
CCGNGGGTTCANGGAANGGGNAGGCCCANCCCGAACAGGGTCCATCCCNCTTCAGAACCA
ANCAAAATCCCATGGAAAGAAGCATCCCCNGGGGCATAAAAATCCNACGGAAATNGGGGG
AGTAATCAAGAGGAGCTGGCCGAGGCCAATCGGATCCAGGCCAACTGTCNTGGACCTTGG
CCACAACNCNCTTCCGANGAGGANGGNCGCACCAATCCAATGCTNGCCTNAAGGAAAGAG
GCATATCAGCCTCCACTGAAGCCAACCAAANGGCCNAAAACANCCCNNCGGNAGGGGNNA
NACCNGNAGACANCAGGANAANAGNCNAGGCNCNCNAGGGNCNANNGGCGCAGCGGGGGG
NACCNAGNNNNCGNNCCCNAGGCGNNCANCNGACAAACAANNNNCNCNNNGGNNNCGGNC
CCGNNGGGGGNGNAGGAAGCCCCCAGNNCGGNGGGCANNANCAGCGGCNGCNNCAGNANC
GCCGGCGCNNCNGGGANCNAANANCCCCNNNNANAGAACCGNNNCCAAGAACCCANNANN
GGNGGGGNCCNNNGNNAGNAAGGGCAANCCNNCCCNACNNGNCNCNGCNNCNNCCCCNNN
CAAANCCAGAANAGCCNCCCcgggcccnaaaaacccnccggaanngggggnnnnancang
aangncncgccngnnncnnncnnncccnnananccngagngnggnccccgnagngncnac
cccnnnnagcggngnnggnngnngagccnnaanngnanngcgggccaangagaggggggn
nnagngngngccccngnanncccnggncnnnnncnnncnnnnncnncncncnnnnnnncc
nnnnnnnnnnncnnnnccnnncnnncnncccanccaannnacnaaaan

Library Name / Clone Name np / np60263_0309
Strand Plus
Insertion Point 20161899
Chromosome Band X
Flanking Sequence
tttnctncgcacttattgcaagncatacgttaagtggatgtctcttgccgacgggaccac
cttatgttatttcatcatgGTGTAGATTGAATTGAGTCGCCTTGCGAGCAACAAGAAGAA
GAAGAAGACGAAAAGAGAGTGTGCGAGTGAGTAAGAGCGGCAAGCGGAGGATGTAATATC
AACAAAACAAAAATAAAACGGGCTCAAAAAAGTGAAGTGAGCAAAACGCAAATTAGTGCA
AAAATAAAAGAGAAAGAGAGGGGACCCCTACCGACATTTCAATACCCTAATAAATTTATT
AAGATCCTCNGCCNGNCGCTTNGGCCACTAGTGGATCTGGATCCTCTAGCTAGGNCTTTG
NGTNCTCGNAAATTATNTAAANTAAAACTTTAAACCNCTCNNCGNCTACTTANNATTATG
AGNNAATNNAAACCCCNCNGNCATGCTNNGNNNAANNANCANNNANNTNTNNNTNTNTNT
CTNNNNCTNNNNNNNNNNNNNNNNTNNNNNNNNTNNNTTNNTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE