Detailed Information [104701]

Strain Information
DGRC Number 104701
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Gclm[NP4502] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}GclmNP4502 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 94C1
Map Viewer
Related Genes CG17625 Gclm CG6954
Original Number 4502
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4502

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1594
General Information NP_lines
Embryonic Expression pns (ch subset)
Larval GFP all gut
Larval X-gal lateral cells, fb, mt, gut
Adult GFP tarsus, internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np14675_0727
Strand Minus
Insertion Point 18502840
Chromosome Band 3R
Flanking Sequence
atctttngggcantnaacctatttgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgGGCCAGGCGGTCGGTGCTCGAGAACACACGCGTTTCACAC
ACCTGAGAGGGCTGCAGTTGTCTGGACGGTCGCGAAAGTAGCAGATACCAAATAAGGAGA
ACACTTGTCACCATGATACCGACCATAACGAAGAANTACCAGAACGTGGTGATTAGCACG
GGCAACATCATCGCCACGGAACTGGGACAGCGCAAATCGAACGAGGAGCTGTACGACGGC
CTGAAGATAACGCTCCACACCGACTCGACTGCGGAGCGCGTGGTGGTTGAAAAGGAgatc
gaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttca
ggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcat
ccctgggcataaaatccaacgggaattgtggagttattatgatgagctgccgagtcaatc
gatacagtcaactgtctttgacctttgttactacctctcttccgatgatgatgtcgcact
tattctatgctgnctcaatggttagaggcatatcagtctccactgagcatnttttttttt
gggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnn

Library Name / Clone Name np / np31755_0907
Strand Minus
Insertion Point 18502840
Chromosome Band 3R
Flanking Sequence
cgtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggaccaccttat
gttatttcatcatgGGCCAGGCGGTCGGTGCTCGAGAACACACGCGTTTCACACACCTGA
GAGGGCTGCAGTTGTCTGGACGGTCGCGAAAGTAGCAGATACCAAATAAGGAGAACACTT
GTCACCATGATACCGACCATAACGAAGAAGTACCAGAACGTGGTGATTAGCACGGGCAAC
ATCATCGCCACGGAACTGGGACAGCGCAAATCGAACGAGGAGCTGTACGACGGCCTGAAG
ATAACGCTCCACACCGACTCGACTGCGGAGCGCGTGGTGGTTGAAAAGGAgatcgaagaa
tacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagg
gcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgg
gcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacag
tcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctat
gctgtctcaatgttagaggcatatcagtctcactngntnnnnnnnnnnnggggggnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE