Detailed Information [105073]

Strain Information
DGRC Number 105073
Genotype with FlyBase Link P{w[+mW.hs]=GawB}CG32816[NP6014] y[*] w[*] / FM7c
Genotype P{w+mW.hs=GawB}CG32816NP6014 y* w* / FM7c
Break points/Insertion Site 1A5
Map Viewer
Related Genes y EG:125H10.1 ac
Original Number 6014
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP6014

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 7
General Information NP_lines
Embryonic Expression weak
Larval GFP mouth part, sg.
Larval X-gal sg, mt, tr, epi
Adult GFP posterior stripe in dorsal abd(epidermal). all over pleura, sternite. ventral thorax, part of notum.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np42145_0912
Strand Minus
Insertion Point 113968
Chromosome Band X
Flanking Sequence
TNNCAAACGTGCACTGAATTTAAANTGTATACCTTCGGTAAGCTTCGGCTATCGACGGGA
NCNCCTTATGTTATTTCCTCATGGGCCAATGANNATGANNACGAANGGCGCGCGCCAACT
TCGGTGGTTTTATTGATTCGGGTGGTTCAGTGTTCGGGTAATCAGGTGGCTTATGCTGTT
CCCATAGATCGAAGANTACATAAGANAGAACCGTCGCCAAAGAACCCATTATTGTTGGGG
TCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCA
TGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCC
GAGTCAATCGATACAGTCAACTGTCTTTGACCCTTTGTTACTACTCTCTTCCGATGATGA
TGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCACTNCATNNNNN
NNNNNNNNGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnn


CLOSE