Detailed Information [105428]

Strain Information
DGRC Number 105428
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Dbp45A[NP7328] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}Dbp45ANP7328 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 45A1; -; 45A2
Map Viewer
Related Genes Dbp45A CG13742 CG8080
Original Number 7328
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7328

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 614
General Information NP_lines
Lethality lethal
Embryonic Expression epi stripe, good driver
Larval GFP sg
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np06745_0711
Strand Plus
Insertion Point 4148633
Chromosome Band 2R
Flanking Sequence
agggggccnggggtgntanggtttnntnggggnngganatnactannnnnttcananaac
ccantnttnnggactnncggaaagaccccggctatcgacgggnaccaccttatnttattt
catcatgTTTCGGNGNATCNNNAGGNACCGAAATGCAACGAAAGGAGGCCAATCCCTTTC
Agatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgt
tttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaaggggggnga
gcatccctgggcataaaatccaacggaattgnggagttatcatgatgagctgccgagtca
atcgatacagncaactgtctttgacctttgntactactctcttccgatgatgatgncgca
cttattctatgctgnctcaatgntagaggcatatcagnctccactgaagccatccnaanc
nggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnncnnnngnnnnnnn
nnnnnnnnnnnnnnnngnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnn
nnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnncgnn
nnnnnnnnnnnnnnncnnnnnnnnnnncnnnnnnnnnnngnnnnnnnnnnngnngnnngn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnaananncnaaaaann


CLOSE