Detailed Information [112092]

Strain Information
DGRC Number 112092
Genotype with FlyBase Link P{w[+mW.hs]=GawB}NP0218 w[*] / FM7c
Genotype P{w+mW.hs=GawB}NP0218 w* / FM7c
Break points/Insertion Site 1B6; 20A1
Map Viewer
Related Genes lcs CG1678 EG:171D11.5 svr
Original Number 218
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0218

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:1B4 only by plasmid rescue
Balancer FM7c
Cluster id 13 499
General Information NP_lines
Embryonic Expression pns large subset
Larval GFP cns, fb
Larval X-gal sg, gut
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05235_0711
Strand Minus
Insertion Point 21071884
Chromosome Band X
Flanking Sequence
gtaangtgcactgaatttaagtgtatacttcggtaagncttcggctatcgacgggaccac
cttatgttatttcatcatgGCTACTGGCATCGGATGGAAATAATTGAACAAAAACACTTT
TCAACACTGCAAATGACAGTTGCGTAAATTCCTAGAAAATATTCGGGGTCGTTGGTTGCT
GAGAGAACGATGCATGTAAATCATACTATTAGAAAGAAGACGAACTTTGTATACAAACAA
AAACCTTGATGAAATTTCACTTACCTCCACGGCCAATAACGTTCGCTTTTATTTCTAGAA
CATTTGCGTAGCCAAAAAAAAAAANTAGGGGGAANTCCTTTTCNCNTCCCCCNGTTCCCC
CNGTANNTTTTTNGNNAAAANANCCNGNTTTTTTAAAAANTNANTNGNNNTGGANNTTAA
CAAACNGNGNGAANCGANGNGCTTTGGCTTNGCTNANGANNGNNGAAGGAACNTTTANCC
CNCCAAATGCAANTTGGTTTNCGGTTTACCCATGGGNTTCCTTTTTTACTTACAAGANNG
CCCNCAGACAACCNTTTACTAAAGGGGNTCCTGTTTTGGAGCTTAAANANNTGGGGNATT
ATAATTTTTTTTTTTTGGGGNNNAAAACGNGNNAAAAAAAAAAAAAANNNTTTNNNNGNT
TTGNNAAAAANAAAANNTTNGTTTTTNANTNNNGGGGTTANGGGGGCCCCNNTTTNCCGN
GGNNTTTAAGGGAAAAAACCTNGGGGAAAGGNTNNNTNCGGNCNCCTNNNNGGGGNTTNN
NAAAAAAAAAGGGTNGNAAAannnaaaaaaaannancnngggggnaaaaaattttnnggg
caaaaactttnnngggggnnnaaaaaaaannctttncnaaacccannnnggggggttnnc
ccccccccccccaaagggggggggnnnnaanccat

Library Name / Clone Name np / np04415_0711
Strand Minus
Insertion Point 256930
Chromosome Band X
Flanking Sequence
gcatttangtgtatacttcggtaagcttcggctatcgacgggaccaccttatgttatttc
atcatgGATTATAGTTTATTCAGGCGCTTTTAATTGTATTATTGTTACCGGAGAGGGAAG
TTGCCAGACTCAATATGTGTGGCGCCTGCGCCTGTGTGTGTGAGTGAGAGACAGAAGAGA
GCGGAGAGAGCTGAAAGAACGGACGTCAACAGGATATTTTTACGCAAAAATCGATAGCTC
CACTCCCACGCCGTGACGTCAGAAGCAACCCCGTCCCGACTCCGACAAACAAACGAATTG
GCACATTCAACCAATTGAGAGCGTTAAAATCGCTCTTNNTCAGTGCTATTTCCAGAATGN
CGAGCATATGGNCGNCACCTTTCCAGTCAGACCCCTTATTCCCCTTTTTACCATCCACAC
CCCGCATTTNAANNGNAGCNTAACGNCCCNTTTTTCTTTGANNAGGCGACGGGTGGCAAC
TTCNTTAAAAACNAAAATGGATNAGCCTCCNGNTCGAAGANATCCATAAGNAGANAANCC
GGNCCGCCAAAGACCCTNTTTNTGGTGGGGGTCCCNTTTCAGGAAAGGGCAANCCTTCCN
CAANGNTTTCCTTTTAAAACNAATAAAATTNCNTGGAGGAGCTNCCTTGGCNTTAAANTC
NAGGGAATTGGGGGNTNTTNTAGGAGANNCCGCCCNGGTAAATCGAANNNAGCAAATGGC
CTTTGNCCNTTGGTNCCTCCCTCTTTCCCGAGANAGAGGGCNCCCCTNNTTTTTTGGCTG
GNNNTAAGGGTAGAGGCATAttagnctccncngagcnccnnnntnntnnnggnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE