Detailed Information [112215]

Strain Information
DGRC Number 112215
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0552 / TM3, Ser[1]
Genotype w*; P{w+mW.hs=GawB}NP0552 / TM3, Ser1
Break points/Insertion Site 95D1
Map Viewer
Related Genes CG12268 Gdh
Original Number 552
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0552

NP line. Received from the National Institute of Genetics.

Balancer CyO;TM3 Ser
Cluster id 1613
General Information NP_lines
Embryonic Expression scattered cells
Larval GFP sg
Larval X-gal wing pouch, gut, epi, mt
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05625_0711
Strand Minus
Insertion Point 19759503
Chromosome Band 3R
Flanking Sequence
atntttttgggnnnnttgnnnntttttttgtatacttcggtaagcttcggctatcgacgg
gnaccaccttntgttatttcatcatgTACATATCTATGCGAGTGCCTCGGCCAGTTTGGT
GCGGCNTNGAGTGGCGAGCGGTTGTGCAGAACAGAATAAAAAAAGAGTTGGAACCCGAAG
AATCCAAGCGATTAGCAGCATGTATCACCTGAAGAGTCTGGCCCNNCAGGGCGCCCGCCG
CCAGCAGGAGCTGGCCACGCTGGCCAAGGCACTGCCCACCGATGTGATGCAGTCGAGCCG
CGGCTATGCCACCGAGCACCAGATTCCCGACCGCCTCAAGGATGTGCCCACCGCCAAGga
tcgaagaatacataaagagagaaccgncgccaaagaacccattattgttggggtccgttt
tcagggaaggcaagccatccgacatgtcattctcttcagaccaatcaatccatgaagagc
attcctgggcataaaatccaacggaattgggggagttattatgatgagctgccgagtcaa
tcgatacagncaactggcttttgacctttggtactactctcttccgatgatgatgncgca
cttattctatgctgnctcaatgttagaggcatatcagnctcactagctnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnna

Image Files
Disc

d1 (->Large)

d2 (->Large)


CLOSE