Detailed Information [112449]

Strain Information
DGRC Number 112449
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}NP1018 w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}NP1018 w* / FM7c
Break points/Insertion Site 1B4
Map Viewer
Related Genes l(1)1Bb Cyp4g1
Original Number 1018
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1018

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 9
General Information NP_lines
Embryonic Expression oenocyte (TU), sg
Larval GFP epi, pns
Larval X-gal epi, hg, mt
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17105_0807
Strand Plus
Insertion Point 228249
Chromosome Band X
Flanking Sequence
gttnttttttnnnnnnattaacctgtgngtgncnctgccctttttttgtgtacttncggt
aagccttcggctatcgacgggnaccaccttatgttatttcatcatgGTTGATGTAGTGGA
AAAGGAAAGGGAACAAAAGAGAGATGAAAGATAACTGTTTCATAATTCgatcgaagaata
cataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaanggc
aagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggc
ataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtc
aactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgc
tgtctcaatgttagaggcatatcagtctccactgagcatctttttttttggggnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnn


CLOSE