Detailed Information [112537]

Strain Information
DGRC Number 112537
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}lolal[NP1149] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}lolalNP1149 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 55B9
Map Viewer
Related Genes CG10914 CG5124 lolal
Original Number 1149
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1149

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 843
General Information NP_lines
Embryonic Expression ventral stripe in abdomenal epi, muscle (subset)
Larval GFP tr
Larval X-gal sg, tr
Adult GFP ubiquitous
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17485_0807
Strand Minus
Insertion Point 13220679
Chromosome Band 2R
Flanking Sequence
gtgcactgncttttgtgtatacttcggtaagcttcggctatcgacgggaccaccttatgt
tatttcatcatgGTTTAAGCTCTGGCGGCAAACTATATGCCCTGCTCTCCCCCGCCCACG
CAGAAACATACAGCCGGCTGCCAGTGTAGCGCATATGAGAGTCGCATCAACAACAACGCT
ATTTCCTCAAGAAGAAAAACACATGTTGGCCGCACAGTGGGATGGAGTGGGAGTGAAATT
AAGACAAAGTCACTGAATGGAAGTGCGAATGGTGCCGCCATCTTGGTTCTTTTTTGGTCA
AAAATCACGGAATGAATGCTATTTAACTGGAGTGCGCCTAAAAATACATTGCCATCGGCA
GCTGCAGCGTGCATCGCGTGCAACAGACTAATTCCGCGTTCTAAGCCACTGTGCCGCATA
CGAATTCAAATAAGCAATAAGTACACATGTGTGTACGACTGAAAATGCAGAAATTGCCTT
GAAAAGTGAAAGGCATTCAACAGAGCGAGCCAGCGACGATTTGATATTTTTGCCTCTTTG
CTTNACCTTTGCTGGCAGCTGTTTGCTGTTTTTATTTTAGCGCTGTCTCAGCACTTTGAC
ATTTTNCAGCTCACTCACACATGTACAGAGTAACAACGCTGTGCATTTCCGAACTTCCAT
TTCCACTGCACAAACGCTGCACATGCGCCGNAGCACATTTATNTTTGCAGAATACTTTTG
GGCCAANANACGTGCTCTTTTGCATGCTCTCGNAACGTTCACTGNTTATTTCGNCCAGCT
GGGGTTGGTTGGCTTACTCTgccttggcggtaccggncggtnactaaggctggctggtta
cttttnttggagaggggggtaaaaaaaanccang


CLOSE