Detailed Information [112774]

Strain Information
DGRC Number 112774
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}NP2087 / FM7c
Genotype w* P{w+mW.hs=GawB}NP2087 / FM7c
Break points/Insertion Site 14A9
Map Viewer
Related Genes disco-r CG9216
Original Number 2087
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2087

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 383
General Information NP_lines
Embryonic Expression cns
Larval GFP sg
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np28095_0807
Flanking Sequence
TTTTTNNNNNNNANNCTTGTNGNAAAAACCCCCCTTTTGGGGNNNNTAAAANCCCGCTTC
GACGGGACCCCTTATGTTTTTTATCATGCCTATGTTATTAAAAGTGGNTCGAAGAATACA
TAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGGTCCGTTTTCAGGAAGGGCAA
GCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCATGAGAGCNTTTTTTGGGCAT
AAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATCGATACAGTCAA
CTGTCTTTGACCTTTGTTACTACTCTCTTCCGATGATGATGTCGCACTTATTCTATGCTG
TCTCAATGTTAGAGGCATATCAGTCTCCACTGAAGCCATCTTATTTCTGGANNNNNNNTN
TTNNNNNNNCNNNNGNNNNNNCCNNNNTNTNNNCCNNNNNNNNTTGNTNNGNNTNTNNNN
NNNNNNNNNCNNGNNNNCAAANNTNTGNNNNNGNNNNTTNNNNNNGNNNNNNNNNNNNNN
NANNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNCNNTNNNNGNNNNNTNGNNNNCC
TNNNNNNNNNNNNNNCNTNNNNNNNTNNNNNNNNNNNNNNNNNCNNTNNNCNNNNNNNNN
NNNNNNNNNCNTTGGNNNCNNNTNNNNNNNNNNTNNTNNNNNNNNNNNNNNCNNNTNNNN
NNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnntnnnnn
nttnnnnnnnnnnnnnnnnnnnnnnnnngnnntnnnnnnnnnnnnnnnntnnnnnnnnnn
nnnnnncnnntnttnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnntnnnntnnntnnnnnnnnnnnnnnnnnnnnnnnntntnnncnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnn
anananaaan

Library Name / Clone Name np / np61553_0309
Strand Plus
Insertion Point 15836018
Chromosome Band X
Flanking Sequence
gcacttattgnaagcatacgttaagtggatgtctcttgccgacgggaccaccttatgtta
tttcatcatgAACATAGGCTTCTCTTAAAGCGTTGTATTTGTATTCATTGTATCTGCAGC
GCTACCGGACTGGCGAGATTTCGTTCTGGCTTAAGTTAAGATTTCCGGCTGACCTGGCCT
ACACCGAAAGAAACGGGTGAAATTGGCATATATCTTATCATATTAATTGAATCAGAAGAT
TGTTTTAATTTCGTATATTCTTATGGCTAAAGAAATGTTTTTAAATTAAATGTTTATAAC
GTAGGATGTATAAATAACAATTTGTTCTTAACAAGCCACTGCAATGGTCCTTGTCGACGA
ACCAAAAATATACTTGCCAACTTTCAAATAATGGGTATACAAAATTATACAGGAGATTTC
TTAACGTGTTGCTTATTTTGGTTCTATTTTTTCAAGTAAGGATATTTTAAGGCGTTGCCA
CAAGTTCGACTTATGGTGTTGCCAGCAGCATGGAATAAGAATGCTGAGAATTCAAATTAT
GAAATTTATTAAAAGTAAGAAATGAAATTATTTGGCTCTTTAAAAATAAATTTAAAAGAT
TGTTTAGTTTGTGCTGAATGNAAATAATGGTAATTTAACAAAAATATACTGCAAACACGT
CAACTCTAAAAATGATCCTCTACTGGGNTNGCTGGGNCNTTGGNNNNTNNGNNNCTTTAN
CTNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE