Detailed Information [112806]

Strain Information
DGRC Number 112806
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}lolal[NP2166] / CyO
Genotype w*; P{w+mW.hs=GawB}lolalNP2166 / CyO
Break points/Insertion Site 55B9
Map Viewer
Related Genes CG10914 CG5124 lolal
Original Number 2166
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2166

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 843
General Information NP_lines
Lethality lethal
Embryonic Expression ventral epi stripe
Larval GFP sg
Larval X-gal sg
Adult GFP abdomen
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np28475_0807
Strand Plus
Insertion Point 13220617
Chromosome Band 2R
Flanking Sequence
cttnttgggngcanaanccccttaantttatncttcggtaagactnccggctatcgacgg
gaccaccttatgttatttcatcatgGGCTGTATGTTTCTGCGTGGGCGGGGGAGAGCAGG
GCATATAGTTTGCCGCCAGAGCTTAAACTTTAGTCTCACGCTCTCTGTGTCCCTCGTTCT
CTTTCGCTAAGCGCTCTCAACTTTCAACTGCCGTTATGATTTCGNNTTTNCATTACAACA
ACAACAACTTAAAAGGCAGAGCAGACATCGCTGGAAATTCAGCTGCATAAGTGTAAGTGT
GTGGCTGTGTGCGAGTGTGGGTAGGCGGCGGCAACTATCTCGCTTGCTCTTGCGCCCGGG
GTTATCGGTAGCTTCTTCTAGGCTGAGTGCATTTCGTTGAATCGTGGATGTTGAAAGTTG
TCTAATTTCCGAACTATTGATTTTTCCCCTTCCCCGTCAAGAAACTGCATTGTTGCTTCT
TGAAGACCAGTTTTGGTAACATCAGGAGAATGGAAAGGAGCGAGTGAGTCGGTGAGTAAG
TGAGTGAGCGATGCGAGCGACAAAATCAACAACAACAACAACGGTTCAAAACGAGTTCCA
ACGAAAGTTGCAACACTCTCAACAATTTGAGCAGCTCCGNTTGGTGGTATTGCATTACTC
AATCGGGAAGAACTCTACACTCGACGGAATAGTGNGCTCGTCTGANAATTAATCTATTTC
NAATNCTTTTCTTTTGGTTTTGGNCANACAATGGCGTCGGCAAACCGTTCGNGGAAAGCC
GAAGAACCACCAAAATGCCTtggngttacatttaccgagcccgcctttggttatgcaaaa
ttattggnatatttgggtaaaatagggcgcgcttccggttcntttttnttttatttcncn
cagnagagccccctacaggnncgtanccccccaacaangggcggtcnanacccttggttt
tttnccnccctttcnaaaatttttttggggggcccggtgttttttttggggggncttttt


CLOSE