Detailed Information [112953]

Strain Information
DGRC Number 112953
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}arg[NP2530] w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}argNP2530 w* / FM7c
Break points/Insertion Site 1B8
Map Viewer
Related Genes arg svr elav EG:65F1.1
Original Number 2530
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2530

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 14
General Information NP_lines
Embryonic Expression pns large subset, cns
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np23825_0807
Strand Plus
Insertion Point 280722
Chromosome Band X
Flanking Sequence
antttntttggggtgcactgccatttttttgtatacttcggtaagcttcggctatcgacg
ggaccaccttatgttatttcatcatgCCTCTCATTCTCATATCTCATAGTTGCCTCTCGA
GCAGCTCTCTCGGGGTTGCAATGGTGTTCGGAGCGAGAGTGGAAGGTAGAGAGCGAAAGA
GTGGCGACATGGGCGTATCTGCGCGCCGAGATAGGGGGTTATTCCNNAAACCTTTAATAT
ATTTTAATAGCTTTAATATATAGCCACCTAACATTTTACCTTAAGTTTTGTTTCTGTAAA
TACCACGTAGAAGTGGAGAAAGTTTTGTCTGATAAGAAACGAGTCTATAATCGTTGCAAA
GTGGAATATTTCTAAGAACCCCTTTTGATACACCCCTGGCTTTCGGCTGCTCTCTCAGTG
GTTTATGCTGTATTCAAAGTTTTTCATGCTTTTTGATACAAATTCAACCgatcgaagaat
acataagagagaaccgtcgccaaagaacccattattggtgggggcccgtttcaggaaggg
caagccatccgacatgtcattctttttagaccaatcaaattcatgaagagcatccctggg
catnaaatccaacggnattggggagttattatgatgagctgncgagtcaatcgatacagg
cnactgnctttgancnttggtaccaccctnttnccatgaagaaggcgcacttattttatg
ctgtctcaatggtagangcatatcagnctcactgagctnnnntttttnnggggnnnnnnn
nnnnnnnnnnnnnnannnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnncccccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)


CLOSE