Detailed Information [112977]

Strain Information
DGRC Number 112977
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2589 / CyO
Genotype w*; P{w+mW.hs=GawB}NP2589 / CyO
Break points/Insertion Site 45A1
Map Viewer
Related Genes CG11824 CG8213
Original Number 2589
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2589

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 611
General Information NP_lines
Embryonic Expression posterior terminal, psp
Larval GFP sg
Larval X-gal sg
Adult GFP internal thorax
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np23225_0807
Strand Plus
Insertion Point 4051775
Chromosome Band 2R
Flanking Sequence
atnttttggtncctgnntttaagtgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgGGTTGACCAATTAATTCAAATGGAGCCGAATTTCACTTTC
GCTAGGCACAGTTTTCGCCTATTACTTTGATTAAGTTAGCTGCTAATCGCACCGGAGgat
cgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttc
aggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagca
tccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatc
gatacagtcaactgtcttgaccnttggtactactctcttccgatgatgatgtcccactta
ttctatgctgnctcaatggtagaggcatatcagnctncactgannttttttttttggggg
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngn
nnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE