Detailed Information [113027]

Strain Information
DGRC Number 113027
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}arg[NP2728] w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}argNP2728 w* / FM7c
Break points/Insertion Site 1B8
Map Viewer
Related Genes arg svr elav EG:65F1.1
Original Number 2728
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2728

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 14
General Information NP_lines
Embryonic Expression cns + pns
Larval GFP cns
Larval X-gal cns
Adult GFP head, thorax, leg, labellum, palpus. haltere, wing(proximal parts is strong) anterior partss of wing(MT)
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np24455_0807
Strand Plus
Insertion Point 281056
Chromosome Band X
Flanking Sequence
tnaaaacgttttttttggnnnggantancnnnggggacaaaaaccccattttttttggga
ctnncggnaagactcccggctatcgacgggacccaccttatgttatttcatcatgGTTTA
TGCTGTATTCAAAGTTTTTCATGCTTTTTGATACAAATTCAACCgatcgaagaatacata
agagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagc
catccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataa
aatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaact
gtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtc
tcaatgttagaggcatatcagtctccactgaagccatcttattctgggnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE