Detailed Information [113156]

Strain Information
DGRC Number 113156
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}lolal[NP3202]
Genotype y* w*; P{w+mW.hs=GawB}lolalNP3202
Break points/Insertion Site 55B9
Map Viewer
Related Genes CG10914 CG5124 lolal
Original Number 3202
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3202

NP line. Received from the National Institute of Genetics.

Cluster id 843
General Information NP_lines
Embryonic Expression somatic muscle from stg 10.
Larval GFP sg, late tr
Larval X-gal epi,
Adult GFP ubiquitous
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np35725_0907
Strand Minus
Insertion Point 13220680
Chromosome Band 2R
Flanking Sequence
ggggnnnnnnnnnnnnnnnnnnnttnnnnnnantnttttggggncanagnccttntttgg
ggactnnnggnaagccctcggctatcgacgggaccaccttatgttattNNATCATGCTCT
GGCGGCAAACTATATGCCCTGCTCTCCCCCGCCCACGCAGAAACATACAGCCGGCTGCCA
GTGTAGCGCATATGAGAGTCGCATCAACAACAACGCTATTTCCTCAAGAAGAAAAACACA
TGTTGGCCGCACAGTGGGATGGAGTGGGAGTGAAATTAAGACAAAGTCACTGAATGGAAG
TGCGAATGGTGCCGCCATCTTGGTTCTTTTTTGGTCAAAAATCACGGAATGAATGCTATT
TAACTGGAGTGCGCCTAAAAATACATTGCCATCGGCAGCTGCAGCGTGCATCGCGTGCAA
CAGACTAATTCCGCGTTCTGAGCCACTGTGCCGCATACGAATTCAAATAAGCAATAAGTA
CACATGTGTGTACGACTGAAAATGCAGAAATTGCCTTGAAAAGTGAAAGGCATTCAACAG
AGCGAGCCAGCGACGATTTGATATTTTTGCCTCTTTGCTTAACCTTTGCTGGCAGCTGTT
TGCTGTTTATATTTAGCGCTGTCTCAGCACTTTGACATTTTCCAGCTCACTCACACATGT
ACAGAGTAACAACGCTGTGCATTTCCGAACTTCCCATTTNCCACTGCACAAACGCTGCAC
ATGCGCCGCAGCACATTTTATATTTTGCAGAATACTTTTGGCCAAGAGACNTGCCTCTTT
TTGCAATGCTCCTCCGAAACggttcactggctaattttcgccaagcctggngtttggttt
ggnctttacttntggccttggccggtanccggttcgatcacttaaaggctggcntgnttt
anctttcnctttggnaanagggcggtnnaaaanaaaaacccccaggcggaaaaccc


CLOSE