Detailed Information [113259]

Strain Information
DGRC Number 113259
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}NP3398 / FM7c
Genotype w* P{w+mW.hs=GawB}NP3398 / FM7c
Break points/Insertion Site ---
Map Viewer
Related Genes CG40262 CG40264
Original Number 3398
Chromosome 1
Comments NP line. Received from the National Institute of Genetics.
Balancer FM7c
Cluster id 2059
General Information NP_lines
Embryonic Expression weak
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np11065_0727
Flanking Sequence
accnttgngtgcactgcattttttgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgCTGCTGCCTTGCgatcgaagaatacataagagagaaccgt
cgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgt
catcctcttcagaccaatcaaatccatgaagagcntccttgggcataaaatccaacggaa
ttgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgnctttgacctt
tgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagag
gcatatcagtctccactgagccatcttattnttggggnnnnnnnnnnnnngnnnnnnnan
ngggnacntnntntnaannntnnnntnnnaggnntnnnnngntntnnnnnnnnnnnngan
gnccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnggnnnnnnnnnnn
nnnnnnnttnnnnnnnnnnnnnntnnnnnnnntnnnnngnnnnnnnnnnnnnnnnnnnnn
nnannnnntnncnnncnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np56273_0309
Strand Minus
Insertion Point 462272
Chromosome Band U
Flanking Sequence
gaaancttggggcaaaaaccncaagttttacgttaagtggatgtctcttgccgacgggna
ccaccttatgttatttcatcatgATCCNCNNGCNAGNGCNTNGGCCACTAGNGGATATGG
ANNCTNTANCTAGANNTNTGATNGCNACTAANTAATANTACNGAGTNAATTCACACCNNN
NGGACATNNTCNAGNTNNTGAATNAATAATAAACACTACGTGACANACAATCTTACATGG
GGGCTCGTCCAGGGGNGAAATCGGTTATATGAAGGNGCAGTTGTTTAAAGAAAAAAGACA
TTGTTGTGTGCGTGGGTATAGTCTTTAAAAGTTGTAAAGTTGNGGCTATATCTATTGCAT
TTAAAGGTGGAAAAATCAGTTGTACAGATTTTGTTTGAACACAAAGTCGGNAAAAGTCGG
GAAAAGCTGCTAGAGAGAACTGATAAAGNTGAAATNGGCGGGGNGCGGGGGATTAAGNCN
TTAAAGGTGGAAAAGTATGGGCTCCGNCTACTGNATTGGAAAGNNGAAAAAAATNGNNTG
GAACNTCATACAGAACCTNAANGNNGGNTTTGGNTGGNGGGGGGAAATTNAAAAAAAANT
NAAATTGGGCAAAGGGGGGGGGAAAAATCGNTTTNTTAAANNAAAAAAAAAAATTTGGNN
TTTTNAAACCCGGGGGGGGNGCCGGNNNGGNAAAAAANGANTCCCGGGNNGNCCNGNNAA
AAAAATTGNNNNNNGNTNGNGGGGGGTAAGGCCCTNNNNNNGGNAANGNNCCCCCCNCCN
CCCCCCCCCNAAAAAAAAAAnttnnacccgccccaaaacaannnntttttagaaanaaaa
gggggggccnannnnnnaaaaaaaaantnnnccnnnaaanncnccnnncnngncngnggn
nnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncn


CLOSE