Detailed Information [113554]

Strain Information
DGRC Number 113554
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP5043 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP5043 / FM7c
Break points/Insertion Site ---
Map Viewer
Related Genes CG40448
Original Number 5043
Chromosome 1
Comments NP line. Received from the National Institute of Genetics.
Balancer FM7c
Cluster id 2157
General Information NP_lines
Embryonic Expression weak
Larval GFP sg only
Larval X-gal sh. not in disc.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np43355_0912
Flanking Sequence
atntttanacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacggga
ccaccttatgttatttcatcatgGGGTGAGTTTGGGGTATGGACGTGGTGAATTAGTTTG
TAAATTAGTATTTTTTTTTTTTTTTTTNGAAANCNAANTTTTAAANNAAAAANNGGGNNG
GGAAAAAAAANAANNTNNCCNGGTTNGTTNCCCTTTAANNANTTAAAANATTTTCNNAAA
ANCTTTAAANTTAAAANCNANCNTNGNNGGNNGGNTTNNTTTNANGGCCCCCCCCCNAAA
NGGNNGNAANCCCCTTTTTNNNGAAAAANTTNGNAANCNTNNNNGNAAAAAANTNNTNNN
CNTNGGNNGGGGNTTTTTTNGANGGCCNNGNNTCCCCCCCCCCCCAAACGNNCCCGGNNG
GGNTTNAAGNNNTTTTTNCCCCCCCCCCNAAANTTTNGGAAANNNCNNTTTNCCCCCTNN
TNGGGNAANNTTNNAAAAAAAAAAATNNTNAATNCCNGGGNNTTTTTTTTNNTNNNAANA
AAANGGNANTNCAAAAANTTCCCANTNCCTTTTTNGGGCCAGGGNNTAAGNCCANNGNCN
AAAAAANNNCCCCCNGAAAAANNNTTTNTNGCCNNNGANAGNCCNAACGNNGGGGCCCTG
GAAANNAAAANAAAAAAAAANTTGGGGAANANNAANATTGGGTTTTGGGTTTTAAAAAAA
GGANAAAATTTTTGTTTTTAANANCNCTTGGCTGGGNGGGAAATTGGGGGGAAAAATTTT
TNTTNGGTTTTTTNGGANTTttttttgggctnaatttttttgggtngggnaaaattttca
aggnccttacctttngggggggggtttttttngggtttttttggaaaantaaangcctaa
tttttgntttngggnnnnaggnccctgggggggnacctttttggaaggggn

Library Name / Clone Name np / np65543_0309
Strand Minus
Insertion Point 318864
Chromosome Band Yh
Flanking Sequence
gtgntncccncccggggcccnccccncccngttttnggnnnngttttttggtngcnttct
tgcagtctacgttagtggntgtctcttgccgcgggnccacctttgttatttcatcatgAC
TCACCCCATGTAATGTAACACTCAAAAACTCAAATAATTGTACCTATATATTGCACCCAC
TGTAATCAAAGGCAAAATAAATAGTGGATGCGGAACAGAATTTATTCTGTCTCCGTACCT
CCACCAGCAAAGTTTAAAATTAAAGAAGTTCTGGTGGCCAACGGACTTCCTTTATTCACC
AACCAGCCCAAGTCCGAGAGAGGATTCCGAGTCATCATCAGACATCTCCACCACTCCACA
CCATGCTCGTGGATAGTCGAGGAACTGCTGAAGCTCGGGTTCCAAGCGCGATTCGTCAGA
AATATGACGAATCCGGCTACAGGTGGCCCCATGCGAATGTTTGAAGTGGAGATCCTNTAG
CTAGNGCATTGGCTACTNGCGNATNTNAANNATNTAACTTGANNNAATGNNNCNNNNANT
AANTTTNNNNGNNNNNNNNANNCNCCNNTNNNTTNTNNNNNNTNNNNNNNNANNNNNNNN
ANANATNNNTNNANNANGNNTNTNATNGGNNCNCNNCAAANNNNNNNNNCGCTTTNNTNG
NNNTNGNNNANNAGNNNNTNGNNNNNNTGGNTANNNANCNANNTNGNANCTNANCNCNAN
ATTATGANTNNNANNNCTNTNGCNTNNNATNTTTTNGANNCNANANTANNNNNNATTAGA
GTNNNNCNTTTGNNCANCCCnnnnntnntnnntntnnnnagncanntntannannnttnc
gcnnccngcnnnnannnttttnnntnttntnctnnnttttntntntnnnnantncgntnc
ntnnnttt

Image Files
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)


CLOSE