Detailed Information [113597]

Strain Information
DGRC Number 113597
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}NP5125 w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}NP5125 w* / FM7c
Break points/Insertion Site 1B9; -; 1B10
Map Viewer
Related Genes vnd Appl 412{}5
Original Number 5125
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP5125

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 15
General Information NP_lines
Embryonic Expression ubiquitous
Larval GFP sg only
Larval X-gal not in discs. (s.g.)
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np38305_0907
Flanking Sequence
NNGNCCANGNGNAANNTTNNGNGNNAAGGAGNNTTTCCCCCCNGGGCNTNNTTTNGNGGC
ACAAAACCCCANCNTGTNNGACTTAGGGAAAGGCCCCGGNTATGCGGACGGGAACCACNC
NTATGNTAATNNTATCCANGGCACACCAGGTAANTTNGACTCCGANTCTCCGGNCNACNG
CTCTCCCACCCCAGNAATCAGAAGNCCAGANACNAANACGACAACNTGNAGCCAGCACGN
NCATTCNATATCCCAGNAGCCCNGAANCACGCAAACGCAACACGCNNCNANCNGCACGAA
AGANANNCNGCNACNCCNACNNNNNAGNNAACNNANANGNTTNNNGNTCANACTACNAAC
ANANCNAAAGNNGGNACGNGGCNNNGNCCCCCCNCACTNCNCNAAANAANNANAANTAAA
ANACTNNTNNAGAANTAGAAGNGGACNAGNNCNNCAGNTNNNCNCGCCCAGGNNGCNCGA
NCNACAACNCGNNCANNANCAGAAAAANNNTAAACANACGNGCCCCACANNATNNANGGG
NGCCNACACCGGCAGCGCAACCGNANNTGNCNNANNGGGGNNNGTGNNGCCGNNNAANGG
GGNNNGCGNCANNNCCNNGCNNACACCCNNGNANNTGTAANCCCCCNCGCNTTNNNNNGC
CACCCCCCCNNAAAGGNGGNACANGAAGNATTCGANGACATACACACNTANNAATTCGCC
NGCNCNCCNNCGANACANGAAAACATNNANNNGCNNCACCGCGCCNCCNNGANTATTTNA
NAAGGGANAANAANAAAGGCagccncancactnnagaggncccncncngagannaangca
tgaantaaagnagnaagaacaaaggnnnnncgaaacnccccgcgngngngcnanagnnna
cgcnnacacgacnnnntnannnnnccnacnncaanaannanagaannanncncnttngcn
nccaccgaaaacncannagtngttnngttnanccncanacnaaagcnnanggnnntanat
aacnngcncgacnnantnnnttnacttcacancaccnaaacaaacagtctncagcgatnn
aacncctnccccccncnttctcnccangnccnctatnnncccnntncccccnnancccca
natnatgngnnnncncccccaccacnttnnanttttcgctnnccncncgcnccgntancc
cgcaagtntttgtttttttnacccccnncnctattcnatcnnncncttntcnncacnacn
cccccn

Library Name / Clone Name np / np64313_0309
Strand Minus
Insertion Point 321308
Chromosome Band X
Flanking Sequence
ttttatgcgccttnntgcagncatacgttaagtggatgtctcttgccgacgggcaccacc
ttatgttatttcatcatgGTCTGTAATCGGCTGAGTTGAAACTTAACAGGGCAACTTGAG
AAGCGCAGAGAGAGGCGCTTAGCACTTCCCTTAATTGGGCGATCNGCGANCGATNANTTC
GGNNANTTAAAACAAGCAACGNGNATAGCTAGCGCATGTGCTAGCTTGGTGCTGTAATNG
GCTGAGGTTGAAACTTAACAGGGCAACGTGAGCAAGCGCAGAGAGAGGCGCTTAGCACTT
CCCTTAATTGGGCGATCAGCGANNNATAGNTTNGCNAAATTAATACTAGCAACGTGCATT
TGGTAACGCTNTATTGGGCAGCTGAGCTAGGAACTCTTTGCCCACACAAACGCACTTNCA
CTCNCAATTGNTTCAGAGGGAAAAAAGGAGGGTGCTTTTGGCGCTATTCAAATACNAGCG
NTTTTATTAACAGNTCTGTTNCNTGACCNCTANCTANNGNATNNGNNNNCTNNNNNNNNN
NNNNNNNNTNCNNNNTNANANCNNNNNNCNNNNTNNNNNTNNTNNANNANCNNNNNNNNN
CNCCNCNNNNNNNNTNCNCNNNNNNNNNNNNCANTNNATNTATNNNTTNNCNNNTCCNNN
NGNNNNCNCTNNAGNCTCTNNNANNANNNNNTACNNNCNNNNTNNNTNNNGNNANNNCCC
NNNNNNNNNCNCCNNNCGNNNNCNCNTCNNNNTGCNNNATNNTNNNNNTTNNNNNTNNTN
NCCCNNNCCCCNTNNNNNNNnnnngncnntcnnnnnnccnncnnnntnttntnnntnnnt
nnnnntntcnncnnnnnatnnnnaantnnnncnnnnnnntannnntnatntnntntcnnn
nnnannnnatnttnnnnnntcnnnatttnnnntnnnncccnncnnnnttaatntnntatc
ncatcnntnnnnnnnn


CLOSE