Detailed Information [113833]

Strain Information
DGRC Number 113833
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}CG32816[NP6066] w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}CG32816NP6066 w* / FM7c
Break points/Insertion Site 1A7
Map Viewer
Related Genes ac sc
Original Number 6066
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP6066

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 8
General Information NP_lines
Embryonic Expression weak
Larval GFP sg, trachea.
Larval X-gal sg, wing disc
Adult GFP uniform in young adult. wing vein, hinge, oc in later.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np42665_0912
Flanking Sequence
gcactgaattaagtgtatacttcggtaagcttcggctatcgacgggaccaccttatgtta
tttcatcatgCTNTGGNNNTGGNTCCCTTAGATAAAGTGCATCGGCTACAGGTGCCACCA
TTACTATTGTTGCTGGNGNNCNGATGCNTTTGTTTGTNTGNGCNTGATGCNACAGTACTT
TNATGNNNCCCANNTTTNGTTNANNNNNGAGNCACAACGACTCACTNTGTNCNGGCCCTT
GCGGGACGGAGCGCGCCANNTTGTGGTGACNNTACGTAAAGTTCCAAGGCCACAAGNGNT
ANAGAACAAGGGTAAAGGTTTTNCGGTNCANTTTTTTGGGTCAAAAAATCCANAAGGGTN
CTCNGNTCNCAAAATACCCAATATTGNACCGGGTCCCCAATNACCNAATGGNGGCNGGTC
CACNTTTNATGCTGNTCAGCCANTCCAATGGTGTACTGTTTACCCGGCATNAAATTCANG
GGATTGCTGGGCATTAANNACNAGNGGACTGGNGAATTAATACANTGAACTGGCCTTGAN
NTTTGTACCNCCACTNTCCNNGACNTTGGNACCACTATTTTACGCTGNCNAAGTGGTACT
GCNTATTGCTGTCACNNGNAGGNNNNTTTTNNNNNNCCCTGAGNTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np65413_0309
Strand Plus
Insertion Point 143031
Chromosome Band X
Flanking Sequence
GNGCCCCCCNCNCGGCGCGCCCGCCCNGGGGCCCGCCCNCGCCCCGGCCTTTCCNCCCNN
GNANNATTGGGGNNACANNACCCTGACAGTCNGACGTTNANGTGGANGTCTNCTTGCCGN
CGGGNCCACCTTAGTTATTTCATNCATGAACCAGAAGCCAAAAAGNAGNAGTAGTTGTTG
AAATGNAAGTGNTGACAAGTGGCAAGTNGAAGGNAATGTGTGCCGNGCTTGAATCAATGA
GCCGAGTGATGACAGNTGAGGAGGATNNNNNANNTAGAGNTANNNNNNACTNNNAAANNA
NNAAAAANAAAANNNNAAAAGGAGNNNNNNANNANNNANNNNNANNNANNNANNNNNANN
NANANNNNNAANANNNNNNNNNANANNNNNNNNNNNNNNNNNNNNANNNNANNNNNNNAN
ANNNNNANNNNANNAANNNNNNANNNANNAANANNAANNNNNNNNNAANANANNNNNANN
ANNNNNNNNNANNNNNNNNANNAANNNANANANNANAANANNANAAAANNNANAANNANA
NANAANNNANNANANNANNAANNNNNAAAAANNANNNAANANANAAAAAAAAAANNNAAN
ANNNNAAANNNNNNNNAANAAANNNAANNANNNNNAAAAANANAAAAAANNANNAAANAA
ANAAANAAANNNANNGNANNNNNAGNAANNAAAAAANANANNNAAANNAAAANAGAANNN
ANANNGNNANAANANNNNANNNAAAGNAANNANNAAANNNNNNANANNAANAAAAAANAN
NNNANNAANAANANGANNNNannnnanngannnnnnannaggnnanagnnanaannnaaa
aaaaanaaanagnnaagnagnagnagnannnaaaannaaananaaannnaaaaaaannna
aanannanananagcacnaaaaccanaananaagagaagnnananaaaaaanagannnnn
nnnnaannnannaagcngnnnnccanccccnccccccccnccn

Image Files
Larval GFP

g1 (->Large)


CLOSE