Detailed Information [113896]

Strain Information
DGRC Number 113896
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG13741[NP6291] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}CG13741NP6291 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 45A2
Map Viewer
Related Genes Dbp45A CG13741 CG8078 CG8080
Original Number 6291
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6291

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 615
General Information NP_lines
Embryonic Expression transient meso, ecot in stg 10. later weak.
Larval GFP fb
Larval X-gal sg, fb, foregut, mt
Adult GFP internal abd
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np46785_0912
Strand Minus
Insertion Point 4153717
Chromosome Band 2R
Flanking Sequence
aacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacctt
atgttatttcatcatgGGCTGGGCCTCTTATCAGTAATGCACAACAAGAAGTACACACGG
ACGAACGAGATGTGAGAAGCGAAAGCGGACGAAAATAGAAACAAACGGCGATAAATTTAC
AGCGAAGGCGATTTTATATACATACATAACCGATGTGCCGGAGACGAACAGAGTAATAAT
CAGTTAATCTGCCAAGCACCCAGAGAGCGGACGTGAAAATgatcgaagaatacataagag
agaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatc
cgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatc
caacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtct
ttgaccctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctca
atgttagaggcatatcagtctccnctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnn


CLOSE