Detailed Information [113940]

Strain Information
DGRC Number 113940
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}lolal[NP6376] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}lolalNP6376 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 55B9
Map Viewer
Related Genes CG10914 CG5124 lolal
Original Number 6376
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6376

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 843
General Information NP_lines
Lethality lethal
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg, oenocyte, fb
Adult GFP uniform
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np48555_0912
Strand Plus
Insertion Point 13221559
Chromosome Band 2R
Flanking Sequence
tgaattaagtgntacttcggtaagcttcggctatcgacgggaccaccttatgttatttca
tcatgGCGTGTACTCTGTACTTTTACCAATGCGTATATCGCCTGCCGACCGCCGCAGGAG
CACGCTAATTGCGCCGTGGACACGCTTTTTCTATATCTTTTTGTTTCAATTTTAATACAT
ACACGCTTTTTTTTTGTCCCGCACTTAACTCACCTCTGCTTTCTCGCTAACGCTGCTTTN
TTTTTTCTCTTTCACCGATTTCGATTTTCGATACACTCGGGATTGTTCGATATGAATCGG
CCTAATTTCGATGCGTTTTGNTTTTTTCCAGTTAATGAACACAAATTAATGGACTGANAT
ATCTTTTATTCGATTTATAACACAAAAAGCATTGNTTGAATTGATGCTTGNTATTTTGNA
CCCCAAAAAANTATAACAATCGGTCAGATCGGAGAATTCCTTAGAGAGNACCGGCGNCAA
ANAACCCATTNTTGGTGGGGGTCCGGTTTCANGGANGGCAAGCCATTCGACATGGTATTC
TTTTNAGACCAATCAAATTCATGAAGAAGCATTCCTGGGCATAAAAANCAACGGAATTGG
GGGGGTTTTAATGAAGAGCTGGCCGGGCAATCCGATACAGGCNAACNGGCTTTGACCCTT
GGGACCACCTTTNTTTCCGAAGAAGGAGGGCNCACCTTATTTNTATGGCGGGTCNAAGGG
TAGANGNATATTNAGTCTNCACTGACATCNNTNNTTTTNNNGGGGGGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE