Detailed Information [114025]

Strain Information
DGRC Number 114025
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6661 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP6661 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 95D1
Map Viewer
Related Genes CG12268 Gdh
Original Number 6661
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6661

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1613
General Information NP_lines
Embryonic Expression weak
Larval GFP fb, gut
Larval X-gal wing pouch, fb, gut, mt
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np01385_0711
Strand Plus
Insertion Point 19759496
Chromosome Band 3R
Flanking Sequence
nttcttggggngaaaacccctttntttgtatacttcggnaagccttcggctatcgacggg
accaccttatgttatttcatcatgGATATGTATATATATGTCGGCTTTTTCGGAGCGCCG
AGCTTTTGGCTCTCCGGCGAGAGCGGTGCAAACTTTTCACCGAAAAGCTCTGTGGGTGGA
GTGCCCGCTAGAAACGCGGCACCACCGCCGGCGGATTACTNGCTTCGTTGCCAGGGCGAG
ATTAGGTATTTGTTATCGGTTTCACGTTCACGTTTTTCTTTGACTCCAAGATTAAGCTAT
GATTTATCATCTTCGGCTATATGTTGAATTCAGGGGGGTACTGAGTTTCTTTTAGAAAGC
ACTTGAAAATCTAAGTAATAAACATCGTACAGTACAATACAAAACGATATATACAAGGGT
ATATTTTATATAAAGGTGTTTTTTTAAAGGGTTTTGCTAAAATTTTTTTATTTAGAGCCT
CATACCTTTCAGGGATTTACCCACGTAACTTTCGGGCCTTATCATGCCTATTGGATCGAA
GAATTCNTTAAGGAGAGAACCGNCGCCAAAGAAACCATTTATTGTTGGGGGNCCGGTTTC
AGGGAAGGGCAAGCCCATTCCGANNNGTCNTNCCTCTTTCAGACCAAANCCAAATCCATG
AANAGGCNTNCCCTGGGGCATNAAATCCAACGGGAATTGNGGGNGTTATTNATGGATGAG
CCTGCCCGAGTNAATCGGATACAAGCAACTGGTCTTTGGCCCTTTGGTTACTACTCTCTT
CCGATGATGATGTCGCACTTaatttnatgctgncttcaatgntagagnatatcagctccn
gntnccnnnntnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)


CLOSE