Detailed Information [114143]

Strain Information
DGRC Number 114143
Genotype with FlyBase Link P{w[+mW.hs]=GawB}CG3777[NP7201] w[*] / FM7c
Genotype P{w+mW.hs=GawB}CG3777NP7201 w* / FM7c
Break points/Insertion Site 1A3; -; 1A4
Map Viewer
Related Genes CG32816 EG:125H10.1
Original Number 7201
Chromosome 1
Comments NP line. Received from the National Institute of Genetics.
y[*] seems to be fixed. 2008/12/25 H.Y.
Balancer FM7c
Cluster id 6
General Information NP_lines
Embryonic Expression scattered cells
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05755_0711
Strand Plus
Insertion Point 100202
Chromosome Band X
Flanking Sequence
ACANACCTNGGGGGAAAAAAACACCCCNANNCTGGGGGNCNAAAAAAAAACCCCCNCCCA
ACGACGGGNACCTNTTTTTGGGATNNCATTATGAAAAAANACCNGNGGGCGNCGCACCAC
NCTCNNNAGCGGATACAAGACCCCAGAGGCCGANGNNACCGANAGGCNGAGCCGAAGCTG
AAGTCGAAGNCGNAGCCNCTGCCGCNGACACAGNGNCANTCGACGGTNNTTTTAATNGCA
ACGGCAACGGTTTTTGAGGGGGGAAGCGCCCATCANNNNGCCAANNCACGGNCAGCTAGC
AGGGAGNNGGGNGGGGGACCGCNCCCCGAAGAGCGAAGAANACAGAAGAGAGAACCGNNG
CCAAAGAACCCAANANGGGGGGGGGCCGNNNNCAGGAAGGGCAAGCCANCCGACANGGCA
NCCNCGNCAGACCAANCAAANNCANGAAGAGCANCCCGGGGCANAAAANNCAACGGAANN
GNGGAGGNANNANGANGAGCNGCCGAGNNAANNGNNACAGACAACNGANNAGGACCNNNG
NGACNACNCNNCNNGGAGAAAANGNGGCACCNNAGNGACGGNNNAGAANGNGGGNGGGNC
NNAAGGNGGCACNGNAGCCAGGNGNNNNGGCGGGGGGCGNNCCGGGNGGNNNNNNCCCNC
GNNNNCGNCGANNGNNNGAAANNCCNNGNNGGCCNNNCANGGGNNNGNCCCGCGCCNCGN
NCNNGNNNNNNNNNNCCCNCCCCNCNNNNCGNCGGNGNCNNCCCCCCCCGGGGGGNNCGG
GGNGNNGGNGGGNNCCGNGNnnngagnngcacacgnnggggncnncngcncnccnggggg
ggnngggcggggcccgcanccncngnnngngnggggngggaaaaangngnggnnagnnca
annnnggcganaannnaaagaaaaaaaaaaaaaaaaaan

Library Name / Clone Name np / np55023_0309
Strand Minus
Insertion Point 100303
Chromosome Band X
Flanking Sequence
antttttactgcgcacttattggcaagtcatacgttaagatggatgtctcttgccgacgg
gnaccaccttatgttatttcatcatgGGCAGGAGTGACGATACAGTATGTACATATATAT
ATATATATGTNCACTTTTTNTGTTATGACCATGCTAAAACTAAATCATTTACACCTGCAG
TCGATCCTCTAGCTAGNGGCTTTGGCCACTAGTGGATCTGGATCCTNTAGCTAGAGGCTN
TGNTTNCGTNTAATTAATATTANGAGTNAATTCAAACCCCACGGACATGCTNAGGGTTAA
GAAANAATNAAANNNNNNNGNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE