Detailed Information [114178]

Strain Information
DGRC Number 114178
Genotype with FlyBase Link P{w[+mW.hs]=GawB}CG3777[NP7251] y[*] w[*] / FM7c
Genotype P{w+mW.hs=GawB}CG3777NP7251 y* w* / FM7c
Break points/Insertion Site 1A3; -; 1A4
Map Viewer
Related Genes CG32816 EG:125H10.1
Original Number 7251
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP7251

NP line. Received from the National Institute of Genetics.

Original Comments comment2:inconsistency in map position
Balancer FM7c
Cluster id 6
General Information NP_lines
Embryonic Expression beautiful tr pattern
Larval X-gal sg, epi, tr (all)
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Shuai Y, Hirokawa A, Ai Y, Zhang M, Li W, Zhong Y.
Dissecting neural pathways for forgetting in Drosophila olfactory aversive memory.
Proc. Natl. Acad. Sci. U.S.A. (2015) 112(48) E6663-72 [PubMed ID = 26627257] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05885_0711
Flanking Sequence
tgngnngttttttttgggnngnacntactgngggntcaaaaaccccccttttttngactt
ncggtaagacnccggctatcgacgggnaccaccttatgttatttcatcatgAGCGGAACG
AANACTCACGTTANGGNATNTNGGTACATGAGATTATCAAAAAGgatcgaagaanacata
ctnagagaaccgtcgccananaacccattattgtgtggggtccgtnntnangaagggcaa
gccatccgacatgtcatnctntnnagaccaatcaaatccaggaagagcatccctgggcat
aaaatccaacggaattgnggagtnatcatgatgagctgccgagtcaatcgatacagacaa
ctggctttgaccttnggnactactctcttncgatgatgatgtcgcacttattctatgctg
tctcaangctagaggcatatcagtctccactgaagccaatcntatntgnaangnnagagg
catatcannctccacngaagccaatntnatgtgnnnnnnnnnnnnnnnncnnnnnnnnnn
ncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnanannn
nanaannnnaannnnannnnnnaaaaaaannannanannnnnnannnnnnnannnannnn
nnannaannannnnnnannngnannnntnnncnannnnnnannnnannnnnnnnnnnnnn
nnnnnnanannnnnnnnnnnnnannncannnnnnnnnnnnnnnnnnnccntncnnnnnnn
nnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnncacn
nnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnncncnnnnnnnnnnnncnnnna
nnncaannnannnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnannncaaca

Library Name / Clone Name np / np55083_0309
Strand Plus
Insertion Point 100296
Chromosome Band X
Flanking Sequence
tttttactncgcacttattgcaagtcatacgttaagtggatgtctcttgccgacgggacc
accttatgttatttcatcatgCTCCTGCCCATCGTTCTTCGCTCCTCTCTCTTTAGCGTA
TACAAGACCCCAGAGGCCGATGTTACCGATATTTTGAGCCGAAGCTGAAGTCGAAGTAGG
TAGCCTCTGCCGCTGTCACTGCTTCAGTCGACGGCGGCAGAATCGCAACGGCAACGGTTT
TAGATGGCTGAAGCGNTCATCATTTTGCCATTTCACGTTCAGCTAGCAGCGAAATCGAAA
GTGACTGCTCCCCCAAGAAAACNCTANCNAGAGANTTTGGGNACTCGCGGATTATTTAAA
AAAAANTNTGAAAAAAAGTTCCCNTAAAAATATNAANAGGGAAATTNAAAACCCCGNGNC
CTNGCNAAGGGTAAAAANNAATNAAATCNGTGGGNAACTCAAACNGGNNNGGNANCNNAA
ANAACNNTNNNNNNCNNNNNCNNTTNNNGANNCNAACNNANANNGGNNGNNNNTNNCCNN
NNNNCCCNNNANNNTANNNNANNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNTTNNNNN
NNNNNCANNANNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnn


CLOSE