Strain Information | |
---|---|
DGRC Number | 103493 |
Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}l(2)k09913[NP0009] / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | w*; P{w+mW.hs=GawB}l(2)k09913NP0009 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 59C3 |
Map Viewer | |
Related Genes | Dox-A3 l(2)k09913 |
Original Number | 9 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP0009 NP line. Received from the National Institute of Genetics. |
Balancer | CyUW14 |
Cluster id | 922 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | sg, cns + pns subset |
Larval GFP | gut |
Larval X-gal | gut, fb, mt |
Adult GFP | abdomen |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2022-11-22 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np51765_0227 |
Strand | Minus |
Insertion Point | 18111079 |
Chromosome Band | 2R |
Flanking Sequence | gngggcncgnnnngttntgtttttttggnnnngatnactgnnggtcataaaccctanttt ttngacttncggtaagacttcggctatcgacgggnaccaccttatgttatttcatcatgG ACTGAACTTTGTACCCAGTGCAGACGAGTCTCAATTTGTATTGTCAAATGGCCAGAATGC TAAATTgatcgaagantacataagagagaaccgtcgccaaagaacccattattgttgggg tccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatcca tgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgcc gagtcaatcgatacagtcaactgnctttgacctttgttactactctcttccgatgatgat gtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgaagccatc nnaatnntgnannannntccacngaagncgatgnnntnnnnttnnnnnnntnctgnnnna angnnnnaggnntnnnagnntnnantgnnnnnatnnannttgnnnncnnnnnannnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnntnnnnn nnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnntntnnttnnnnnnnnnnnnnnnnnn nnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnn tntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnttnttntnnnnnnntnntntn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnaatnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnntnnnnnnnnntnnn |
Image Files | ||
---|---|---|
Disc |
|