Detailed Information [103788]
 

Strain Information
DGRC Number 103788
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}ago[NP0850] / TM3, Ser[1]
w*; P{w+mW.hs=GawB}agoNP0850 / TM3, Ser1
Break points/Insertion Site 64A12
Map Viewer
Related Genes CG1265 ago
Original Number 850
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0850

NP line. Received from the National Institute of Genetics.

Balancer TM3 Ser
Cluster id 1773
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression a small # of cells
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Nicholson SC, Nicolay BN, Frolov MV, Moberg KH.
Notch-dependent expression of the archipelago ubiquitin ligase subunit in the Drosophila eye.
Development (2011) 138(2) 251-60 [PubMed ID = 21148181] [RRC reference]

Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np09535_0727
Strand Minus
Insertion Point 4232798
Chromosome Band 3L
Flanking Sequence
gaaangtttttttggnnggannaaacnngggganaaaaaccccttttttggggactnncg
gaaaagaccncggctatcgacgggnaccacctttatgttatttcatcatgCTCGATGCAC
TTTTGTGATTTCCTTTTTCGAGTTCCAACGACGCCGGCAGAGGCAGCGTCGTTACAACAA
ATTTTTCCCACTGCTTTTCATTCCCTTGGATTTCATTTTTTTTGCAACCATCAGTTTGCG
CTTGTTGCGTGGGAATTTCGgatcgaagaatacanaagagagaaccgtcgccaaagaacc
cattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcag
accaatcaaatccatgaagagcatccctgggcataaaatccaacggaaattgtggagtta
tcatgatgagctgccgagtcaatcgatacagncaactggctttgacctttngntactact
ctcttccgatgatgatgtcgcacttattctatgctggctcaatgntagaggcatatcagt
ctccactgaagccatnnnnttnttgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE