Detailed Information [103898]

Strain Information
DGRC Number 103898
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1131 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1131 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 38B1; ---
Map Viewer
Related Genes CG10659 CG13966 CG40262 CG40264 blastopia{}423
Original Number 1131
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1131

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1257 2059
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP mt
Larval X-gal mt
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Bai L, Sehgal A.
Anaplastic Lymphoma Kinase Acts in the Drosophila Mushroom Body to Negatively Regulate Sleep.
PLoS Genet. (2015) 11(11) e1005611 [PubMed ID = 26536237] [RRC reference]

Zhang X, Ren Q, Guo A.
Parallel pathways for cross-modal memory retrieval in Drosophila.
J. Neurosci. (2013) 33(20) 8784-93 [PubMed ID = 23678121] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03175_0711
Strand Plus
Insertion Point 19985873
Chromosome Band 2L
Flanking Sequence
antacttgggtgcactgccnttttttgtatacttcggtaagcttcggctatcgacgggac
caccttttgttatttcatcatgCTTCAGAGCATTAATCAAGACCGACCAGGTGGAAGCAA
GCCACAACGTTTTAGTCGTCCACGATTCTAAATTCAGTTGCGATGGAATAGTGGGACACG
ATTTTATCAGCAAGTTTCGTCTTATCTGTAGTGCAGAAGGNTATACTTTTCTTGACCTGG
AAGCAGATAAAAAACAAGCGGTTGAGTATTCCCAAATGTTTAATATTTGTGAAGAATCTT
CTTTTACAGTTGCACCACAATACCGAGAAGACGTTGAACGCATGATAGAGAGAACATACG
AAACACCACCCAAGCAGATAAAGCAATGTCCAGTCGAACTCAAAATTATTCCTGATGGCG
TGATTAAACCCTTTCGCCATGGACACACCCGACTATCTGAAGAAGAAGCTATAGCTGTAA
AGAAGCAGGTAGAGGAATGGGGTCGAGCAGTCAATCGTCCGTAAATCTACATCAAATGGT
TGCCAGGTCGCATTAGTTCGTTGTCAAAGAAAAAGGATGGTACCCTACCGCGTTTTGCGG
TGGGNCTTTTAGAAAAATTGGAACANCCATGGGTTCTGATGGGATGGTTTTCCGGTACCC
CATAATGGGAGGGGGGGGCNTNGAAAAACTGCAGANNGCCAAAAGGGTTTAAAACCATGG
GNCTTACCAGAAACGGGTTTTTTTTATTGNGGCCCGNNAGAAGAAANGCCGCCAAGGCCG
NACACNAGCATNTTTGTTNCcccgaagaagggtttttttcgagnttaaanaaagcncccc
ttttgggttttaagaattccccancagcgntttatccnggtcggtcaattattttttcag
gaactnatcatttccaattaangcngcttnttntgggngnntaatatggtttngccgctc
cccnaaaaangctggaaaaaagggaanggntctttaaaagg

Library Name / Clone Name np / np54273_0309
Strand Plus
Insertion Point 460513
Chromosome Band U
Flanking Sequence
ggngnnnngnnttggnnggnnngnnngttttttggnngantaacnnntgnncntnanngc
antntacgttagtggnngtctcttgccgacgggnaccccttatgttatttcatcatgCTC
TGAAGCATCCAATCGGCTGTGTTGAGGCATTTCCCAAACCTCGCAATACTGTTGCAGTGC
GGTTTAAATCAACATCTTTCATCTTCTTGAATATAGCTTCTTTAATTATGGGCACATNTG
ANCCTNTAGCTNGAGNTTTTGNGGGACNNGCAAATTATTAAAAATAAAACTTTAAAAAAA
NTTCNNNTAAATAANAATNAGNNGTAANTTAAAACCCNACGGCCATGCTAAGGGTNAATN
AACAATNATATNGCTGTNTCACTCANACTCAANACGNNNNCNAAAATACTATNCCTTNNN
CTNNCACTNATTGNANGNAAACGNNAANNGGATGTNNNTNNNNNNNNNNCCACNNNNNNT
TNNNNNANNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNCNNNNNCNNNNN
NNNNNNNNNNNNNNNGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaa
aaaaaan


CLOSE